ID: 932056619

View in Genome Browser
Species Human (GRCh38)
Location 2:68449485-68449507
Sequence GGAGCATCCTGGATCCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932056619_932056626 24 Left 932056619 2:68449485-68449507 CCATCCAGGATCCAGGATGCTCC No data
Right 932056626 2:68449532-68449554 TATGGCTGAGTAGTATTCCATGG 0: 793
1: 2575
2: 28071
3: 15480
4: 7359
932056619_932056624 6 Left 932056619 2:68449485-68449507 CCATCCAGGATCCAGGATGCTCC No data
Right 932056624 2:68449514-68449536 CATTATTTTGTTCCTTTGTATGG No data
932056619_932056627 29 Left 932056619 2:68449485-68449507 CCATCCAGGATCCAGGATGCTCC No data
Right 932056627 2:68449537-68449559 CTGAGTAGTATTCCATGGTGTGG 0: 13
1: 87
2: 404
3: 1046
4: 2461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932056619 Original CRISPR GGAGCATCCTGGATCCTGGA TGG (reversed) Intergenic
No off target data available for this crispr