ID: 932057947

View in Genome Browser
Species Human (GRCh38)
Location 2:68466444-68466466
Sequence CTGCAGTCTGTGTTCAACAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 234}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932057946_932057947 1 Left 932057946 2:68466420-68466442 CCAGATTAGCTGTGGTGGCTGGA 0: 1
1: 0
2: 1
3: 10
4: 128
Right 932057947 2:68466444-68466466 CTGCAGTCTGTGTTCAACAGAGG 0: 1
1: 0
2: 2
3: 15
4: 234
932057941_932057947 13 Left 932057941 2:68466408-68466430 CCCATTCATGATCCAGATTAGCT 0: 1
1: 0
2: 1
3: 4
4: 128
Right 932057947 2:68466444-68466466 CTGCAGTCTGTGTTCAACAGAGG 0: 1
1: 0
2: 2
3: 15
4: 234
932057940_932057947 24 Left 932057940 2:68466397-68466419 CCACGGTGGCTCCCATTCATGAT 0: 1
1: 0
2: 1
3: 3
4: 72
Right 932057947 2:68466444-68466466 CTGCAGTCTGTGTTCAACAGAGG 0: 1
1: 0
2: 2
3: 15
4: 234
932057939_932057947 30 Left 932057939 2:68466391-68466413 CCAAGACCACGGTGGCTCCCATT 0: 1
1: 0
2: 0
3: 6
4: 97
Right 932057947 2:68466444-68466466 CTGCAGTCTGTGTTCAACAGAGG 0: 1
1: 0
2: 2
3: 15
4: 234
932057942_932057947 12 Left 932057942 2:68466409-68466431 CCATTCATGATCCAGATTAGCTG 0: 1
1: 0
2: 0
3: 11
4: 123
Right 932057947 2:68466444-68466466 CTGCAGTCTGTGTTCAACAGAGG 0: 1
1: 0
2: 2
3: 15
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932057947 Original CRISPR CTGCAGTCTGTGTTCAACAG AGG Exonic
902281893 1:15380845-15380867 CTGCAGTCAGTGTTGAACGCAGG + Intronic
902647917 1:17816619-17816641 TTGCAGGCTGCGTGCAACAGGGG - Intronic
904201984 1:28825850-28825872 CAGCACGCTGAGTTCAACAGTGG - Intronic
904651251 1:32007523-32007545 CTGCAGTTTGGGTTCTACTGGGG + Intergenic
907219671 1:52897069-52897091 CTGCAGGCTGTGTTCAATGTAGG - Intronic
909021907 1:70440965-70440987 CTGGAGTCAGTGTTTCACAGTGG + Intergenic
909947906 1:81684203-81684225 CTCCACTCTGTTTTCCACAGTGG + Intronic
910672150 1:89784267-89784289 CTGCAGTCTCTGCTCAACATGGG - Intronic
912957110 1:114162914-114162936 CTCCAGACTGTTTTCCACAGTGG - Intergenic
915668419 1:157466031-157466053 CGGAGGTCTGTGGTCAACAGTGG + Intergenic
915938195 1:160101120-160101142 CCGCAGTCTGGGTTCCAGAGGGG - Intergenic
916360127 1:163958922-163958944 CTGCAGGCTGGGTACTACAGTGG + Intergenic
917975803 1:180236839-180236861 CTTCAGTCTGTCTCCAACCGTGG - Intronic
918930367 1:190847500-190847522 CTCCAGACTGCTTTCAACAGTGG - Intergenic
919862824 1:201753227-201753249 CTGCAGTATGTATGCCACAGTGG - Intronic
921590643 1:216999120-216999142 ATGCAGTCTGTGGTCCAGAGAGG - Intronic
922889707 1:229052134-229052156 CTGCACACTGTTTTCCACAGTGG - Intergenic
923946528 1:238894305-238894327 ATGCAGTGTTTGTTTAACAGAGG - Intergenic
924076400 1:240342218-240342240 CTGCTCTGTGTTTTCAACAGAGG + Intronic
1063178238 10:3571210-3571232 CTGCAGGCCGTCTTCCACAGTGG - Intergenic
1063448178 10:6133449-6133471 ATGCAGACAGTGTTCATCAGTGG - Intergenic
1064700909 10:18020540-18020562 CTCCAGACTGTTTTCCACAGTGG + Intronic
1066069746 10:31795478-31795500 TTGGAATCTGTGTTCACCAGAGG + Intergenic
1068446641 10:57133563-57133585 CTACAGTCTGTCTTCAAGAAGGG - Intergenic
1070525429 10:77292218-77292240 TTGCAGGCTGGGTTTAACAGTGG - Intronic
1070622674 10:78025778-78025800 CAGCAGTCTGTGTTGATCATTGG - Intronic
1072439946 10:95445536-95445558 CTTCAGTTTGAGTTCACCAGAGG + Intronic
1074502870 10:114043016-114043038 CTGCACTCGAGGTTCAACAGAGG + Intergenic
1076449010 10:130543346-130543368 CTGAACTATGTTTTCAACAGAGG - Intergenic
1079015105 11:16862165-16862187 CTGCAGCCTGTGTTCAAGAAAGG - Intronic
1079768700 11:24430201-24430223 CTGCATTTTCTGTTCAACAGGGG + Intergenic
1081641540 11:44758913-44758935 CTGCTGCCTATCTTCAACAGGGG - Intronic
1082039438 11:47672841-47672863 CTGTAGTCTGTGGTGGACAGTGG - Intronic
1083053785 11:59800515-59800537 CTGCAGCCTGTCTTCAGGAGCGG + Intronic
1083210187 11:61179275-61179297 CTGCATTCTGTTTTCCACAGAGG + Intergenic
1084803404 11:71562214-71562236 CTGCAGACTGTTTTCCACAGTGG - Intronic
1086074758 11:82838467-82838489 CTGATGACTGTTTTCAACAGTGG - Exonic
1086701184 11:89901753-89901775 CTCCAGACTGTTTTCCACAGTGG + Intergenic
1086704983 11:89942774-89942796 CTCCAGACTGTTTTCCACAGTGG - Intergenic
1087530175 11:99371036-99371058 CTGCAGCCTCTGTTGAAGAGAGG + Intronic
1087725651 11:101713256-101713278 CTCCAGACTGTTTTCCACAGTGG - Intronic
1087773543 11:102237047-102237069 CTGCAGGCAGAGTTCAGCAGAGG + Intergenic
1088470805 11:110186235-110186257 CTGCAGTGTGTGTTTATCATTGG - Intronic
1090222612 11:125042892-125042914 CTGCAAACTGTTTTCAAAAGTGG + Intergenic
1091958751 12:4672506-4672528 CAGCAGTCTGAGTTCAACCTGGG + Intronic
1093153608 12:15653620-15653642 CTGGAGTCAGTGTTCATCATTGG - Intronic
1095480376 12:42628877-42628899 CTCCAGCCTGGGTGCAACAGAGG - Intergenic
1095904108 12:47359747-47359769 CTCCAATCTGTTTTCTACAGTGG + Intergenic
1097448604 12:59708216-59708238 TTGCAGTCTTTCTTCAACTGTGG + Intronic
1097812736 12:64036058-64036080 CCAGAGTCTGTGTTCATCAGCGG + Intronic
1098023273 12:66176303-66176325 TTGCAGTGTGTGTTCAACTTTGG - Intergenic
1099570703 12:84314090-84314112 CTGCACACTGTGTTCATCAGAGG - Intergenic
1104105049 12:125650979-125651001 CAGCAGTCTGTGTTGATGAGTGG + Intronic
1104325968 12:127798887-127798909 CTTAAGTCTTTGTTCAAGAGAGG - Intergenic
1104490017 12:129186048-129186070 CTGTGGTCTGTGGTCAGCAGGGG - Intronic
1105442782 13:20429376-20429398 TTGCACCCTGTGTTCAACTGTGG + Intronic
1106383058 13:29258510-29258532 CTGCAGGGTGTGTCCACCAGGGG + Intronic
1106578999 13:31001533-31001555 CTGCTTTCAGTGTTGAACAGAGG + Intergenic
1107471237 13:40693220-40693242 CTGCAGACTGTTTTCTACAGTGG - Intergenic
1108232258 13:48358620-48358642 CTGCATACTGTGTTGAACTGGGG - Intronic
1109467435 13:62755386-62755408 CTCCAGTCTGTTTTCCATAGTGG - Intergenic
1112006207 13:95255772-95255794 CTGCACTCTGGGTTCAACATGGG + Intronic
1113179966 13:107613417-107613439 CTGCAGACTGTGGTCAACAGTGG + Intronic
1115163755 14:30424825-30424847 CTGCTGTCTGTTCTCAACATCGG - Intergenic
1117118875 14:52547695-52547717 CTGCCTTATGTGTTCAACAGGGG + Intronic
1119799630 14:77431590-77431612 CTGCAGCCTGTTTTCCACATTGG - Intronic
1119943506 14:78666882-78666904 CTGCAGTTTGTCTTCAACTTGGG + Intronic
1120809217 14:88785827-88785849 CTTCAGTCTGTTCTCAACATAGG + Intronic
1121355166 14:93207625-93207647 CTTCAGCCTGTGTCCAGCAGGGG + Intronic
1124083319 15:26521258-26521280 CTGTAATCTGTTTCCAACAGAGG - Intergenic
1125022107 15:34996038-34996060 TTGCAGTCTGTGGACAGCAGTGG + Intergenic
1125856717 15:42956940-42956962 CTGCAAACTGTTTTCCACAGTGG - Intronic
1127321595 15:57852025-57852047 CTGCAGTCAGAGATCAACTGAGG + Intergenic
1128268769 15:66290832-66290854 CCACAGTCTGTGTTCCAGAGAGG + Intergenic
1129599688 15:76991286-76991308 CTGCATTCTGCGTTCCCCAGCGG - Intergenic
1129856499 15:78828983-78829005 CTGCAGTGTGTCTTCTACTGGGG - Intronic
1130393903 15:83485181-83485203 CTGAAATCTGTTTTCAACTGAGG + Intronic
1131640955 15:94293295-94293317 GTGAACTCTGTGTTCAACAAAGG + Intronic
1133996629 16:10753381-10753403 CTGCAGTCTCAGTTCCCCAGGGG - Intronic
1135401734 16:22170827-22170849 CTGCAGTCTGTGTTCGCCGGCGG + Exonic
1137035534 16:35566433-35566455 CTGCAGATTGTGTTCAGTAGGGG + Intergenic
1137294784 16:47080338-47080360 TTGCATTTTGTGTTCAACACTGG + Exonic
1138103804 16:54275936-54275958 TTGCATTCTGTCTTCCACAGTGG + Intergenic
1141446970 16:84066539-84066561 CTGCTGTCTGTGTGGAACATGGG - Exonic
1143490578 17:7283317-7283339 CTGCAGTTTGGGTACAACATTGG + Exonic
1144024487 17:11265766-11265788 AATCAGTCTGTGTTCAGCAGTGG - Intronic
1147412813 17:40265830-40265852 CTGCGGTCTGTTCTCAACATAGG - Intronic
1147462078 17:40579478-40579500 CTGCAGTCAGTGTCCAACAAAGG - Intergenic
1151808664 17:76422794-76422816 CTGCAGTCTGTGTGCCCCATGGG + Intronic
1152916543 17:83039639-83039661 CTGCAGTGTGTCTAGAACAGGGG - Intronic
1155372547 18:25117288-25117310 TTGCAGTCTGAGTTCAATAGAGG + Intronic
1156760885 18:40588806-40588828 CTGCAATATGTATTAAACAGAGG - Intergenic
1157039119 18:44017357-44017379 CTTCAGTCTGCTTTCCACAGTGG + Intergenic
1157307313 18:46526563-46526585 CTGCACTCAGTGGTCTACAGAGG + Intronic
1157590955 18:48836269-48836291 CTGCTGGCTGTGCTCAAGAGGGG - Intronic
1157987533 18:52456109-52456131 CAGAAATCTGTTTTCAACAGAGG - Intronic
1158275211 18:55759557-55759579 TTCCTGTCTGTGTTCAACTGGGG - Intergenic
1158433642 18:57416730-57416752 GTGCGTTCTGTGTCCAACAGAGG - Intergenic
1158437742 18:57445692-57445714 CTCCAGGCTGTGTTGAACAAGGG + Intronic
1158628944 18:59095463-59095485 CTCCAGCCTGGGTGCAACAGAGG + Intergenic
1160848654 19:1178891-1178913 CTGCAGTTGGAGTTCAAGAGAGG + Intronic
1163987187 19:20964599-20964621 CTTCAAACTGTGTTCTACAGGGG - Intergenic
927202222 2:20584875-20584897 CTGCAGTGTGTGGGCCACAGAGG + Intronic
928221702 2:29408540-29408562 CTGAAGTCAGTGTTCAATCGAGG + Intronic
928274689 2:29889796-29889818 CTGGAGTCTGTGTCCATCACAGG - Intronic
929845837 2:45526034-45526056 CTGCAGACTGTTTTCCAAAGTGG - Intronic
930051922 2:47223142-47223164 CTGCAGTCTGTTTCCAAGACAGG - Intergenic
931534162 2:63253807-63253829 CTCCAGACTGTTTTCCACAGTGG - Intronic
932057947 2:68466444-68466466 CTGCAGTCTGTGTTCAACAGAGG + Exonic
935350022 2:102144686-102144708 CAGCAGTCTCTCTTCAAAAGGGG + Intronic
936718230 2:115215679-115215701 CTGCATACTGTTTTCAATAGGGG - Intronic
937895285 2:126973154-126973176 CTTCATTTTGTGGTCAACAGAGG - Intergenic
941310716 2:163927459-163927481 CTGCAAACTGCTTTCAACAGTGG - Intergenic
942378289 2:175359526-175359548 CTCCAGACTGTTTTCCACAGTGG - Intergenic
943494348 2:188601604-188601626 CTGCAGTCTATGCTCCTCAGTGG + Intergenic
943641694 2:190366708-190366730 CTTGAGGTTGTGTTCAACAGAGG + Exonic
944085195 2:195837805-195837827 TTACATTCTGTGTACAACAGGGG - Intronic
944248639 2:197558895-197558917 CTCCATTCTGTTTTCCACAGAGG + Intergenic
946036948 2:216751439-216751461 CTGCACACTGTTTTCCACAGTGG - Intergenic
946144310 2:217717533-217717555 CTGCAGTCTATGTTCAAGATGGG + Intronic
947103701 2:226647649-226647671 CTTCAGACTGTTTTCCACAGTGG + Intergenic
1170080237 20:12467162-12467184 CTGCAGTCTGTCTTCACCTCAGG + Intergenic
1171028993 20:21659484-21659506 CTGCATGCTGTTTTCCACAGTGG - Intergenic
1172929793 20:38577927-38577949 CTGCAGACTGGGTTCTAGAGAGG + Exonic
1172957603 20:38772037-38772059 CTGATGTCTTTGTTCAACTGTGG + Exonic
1175916031 20:62426404-62426426 ATGCAGTGGGTGTTCCACAGGGG - Intronic
1177512201 21:22102805-22102827 CTCCATGCTGTGTTCCACAGTGG + Intergenic
1177657643 21:24039919-24039941 CTGTAGTTTCTGTTCAACAAGGG + Intergenic
1178305160 21:31485170-31485192 CTTCAGTCTCTGTTCCTCAGTGG - Intronic
1180187933 21:46149651-46149673 CTGGAGTCTGGGTTCCACCGGGG - Intronic
1180759633 22:18190526-18190548 CTGCAGACTGTTTTTCACAGTGG - Intergenic
1180769946 22:18374827-18374849 CTGCAGACTGTTTTTCACAGTGG - Intergenic
1180776382 22:18487839-18487861 CTGCAGACTGTTTTTCACAGTGG + Intronic
1180809110 22:18745208-18745230 CTGCAGACTGTTTTTCACAGTGG + Intergenic
1180827886 22:18877782-18877804 CTGCAGACTGTTTTTCACAGTGG - Intergenic
1181072031 22:20350186-20350208 CTGCAGACTGTTTTTCACAGTGG + Intergenic
1181195106 22:21179131-21179153 CTGCAGACTGTTTTTCACAGTGG + Intergenic
1181214340 22:21313643-21313665 CTGCAGACTGTTTTTCACAGTGG - Intergenic
1181524799 22:23475265-23475287 CTGCAGACTGGTTTCCACAGTGG - Intergenic
1183258484 22:36778556-36778578 CTTAAGTCTGTGGTCAACATAGG - Intergenic
1185368582 22:50448058-50448080 CTGCAGGCTGTGGTCAGCTGTGG + Intronic
1203231776 22_KI270731v1_random:116011-116033 CTGCAGACTGTTTTTCACAGTGG - Intergenic
1203277984 22_KI270734v1_random:103780-103802 CTGCAGACTGTTTTTCACAGTGG - Intergenic
950111128 3:10419316-10419338 CTGCAGTCTGGGGTTGACAGAGG + Intronic
951444111 3:22757049-22757071 CTGCACACTGTTTTCCACAGTGG - Intergenic
952648450 3:35692004-35692026 CATCAGTCTGTGCTCAGCAGAGG + Intronic
953902284 3:46850113-46850135 GTGCAGTCCGTCTTCAAGAGGGG - Intergenic
956909187 3:73799677-73799699 CTGGAGGCTGTGATCAGCAGGGG + Intergenic
958607950 3:96384276-96384298 CTCCATTCTGTTTTCCACAGGGG + Intergenic
958618147 3:96522915-96522937 CTCCAAACTGTGTTCCACAGGGG + Intergenic
960663846 3:120091229-120091251 CTTATGTCTGTTTTCAACAGGGG + Intronic
961918690 3:130403688-130403710 GTACAGTGTGTGTGCAACAGGGG - Intronic
963553125 3:146750273-146750295 CTTCAGACTGTTTTCTACAGTGG + Intergenic
967029189 3:185590111-185590133 CAGCACTCTGTTTTCTACAGTGG + Exonic
968381031 4:95952-95974 CTGCAGTCTGGGTTCAATCCTGG + Intergenic
968516935 4:1019404-1019426 CTGCAGGCTGTGGGCCACAGGGG + Intronic
969663021 4:8541308-8541330 CTGCAGTGGGTGCTCAAAAGTGG - Intergenic
970716479 4:18932129-18932151 CAGCAGTCTGTATACAACAATGG + Intergenic
971272574 4:25164321-25164343 GTTCGGTCTGTGTTCAAAAGGGG + Intronic
971946421 4:33284903-33284925 CTGCACTCTGGGATCAACTGAGG - Intergenic
974119991 4:57626758-57626780 CTTCAGTCTGCTTTCTACAGTGG - Intergenic
974616374 4:64288237-64288259 CTGCATTGTGTGTTCATTAGCGG - Intronic
975239537 4:72041568-72041590 CTGCAAACTGTTTTCCACAGTGG + Intronic
975615809 4:76245744-76245766 CTCCACTCTTTGTTGAACAGTGG - Intronic
980287965 4:130805990-130806012 CTACAGGCTGTATGCAACAGAGG + Intergenic
981224312 4:142274824-142274846 CTGCTTTCTGCGTTAAACAGTGG - Intronic
981654473 4:147097848-147097870 CTGCACACTGTTTTCCACAGTGG - Intergenic
982832091 4:160075350-160075372 CTGCACACTGTTTTCCACAGTGG - Intergenic
982982629 4:162159639-162159661 ATCCAGGCTGTGTTCTACAGAGG + Intronic
983548157 4:168985459-168985481 CTCCAGACTGTTTTCCACAGTGG - Intronic
983635951 4:169898056-169898078 CTACATCCTGTATTCAACAGTGG + Intergenic
986794576 5:11196824-11196846 CTGCACTGTGTGGTCAACTGAGG + Intronic
986952184 5:13102433-13102455 CTTCAGTCTCTTCTCAACAGGGG + Intergenic
987100145 5:14583635-14583657 CTGCAGTTGGTGTGCAGCAGAGG + Intronic
988790742 5:34605070-34605092 ATGCTGGCTGTGTTCAAAAGAGG - Intergenic
991011991 5:61892730-61892752 CTCCATTCTGTTTTCCACAGTGG - Intergenic
991269904 5:64767784-64767806 CTGCAATCAGTGTTCTGCAGTGG + Intronic
991642915 5:68772379-68772401 CTGCAGTGAGTGTCCCACAGTGG + Intergenic
994826009 5:104713335-104713357 CTGGACTCTGAGTTCCACAGGGG + Intergenic
1000419590 5:161023124-161023146 CTGCAGTCTGTGTTCTATTTTGG + Intergenic
1001246630 5:170109774-170109796 CTGCCTGGTGTGTTCAACAGGGG + Intergenic
1003557318 6:7151676-7151698 CTGCAGTGTGTGCTCAGCAGTGG - Intronic
1004822754 6:19385622-19385644 CTCCATTCTGTTTTCCACAGAGG - Intergenic
1005146290 6:22693885-22693907 CTGGAGGCTATGTTCAACTGGGG - Intergenic
1005451220 6:25974573-25974595 CTTGAGTCTGTCTTCCACAGTGG + Intronic
1005530568 6:26701170-26701192 CTCCTGTCTCTTTTCAACAGAGG + Intergenic
1005540228 6:26800476-26800498 CTCCTGTCTCTTTTCAACAGAGG - Intergenic
1006731500 6:36239579-36239601 CTGGGGTCTGTATTCAAAAGTGG - Intergenic
1008338449 6:50335376-50335398 CTCCACACTGTGTTCCACAGTGG - Intergenic
1008724149 6:54395496-54395518 TTTCAGTCTTTGTTCAACACAGG + Intergenic
1009011043 6:57842577-57842599 CTCCTGTCTCTTTTCAACAGAGG - Intergenic
1009059729 6:58384489-58384511 CTGCAGTTAGTTTTCATCAGTGG - Intergenic
1010104393 6:72149877-72149899 CTGTATTCTGTGCTCACCAGGGG + Intronic
1010623553 6:78106964-78106986 CTGCACGCTGTGTTCTCCAGAGG - Intergenic
1011107022 6:83793469-83793491 CTCCAGACTGTTTTCCACAGTGG - Intergenic
1011900333 6:92286775-92286797 CTGCATTCTGTTTTCCATAGTGG - Intergenic
1012141103 6:95627971-95627993 CTCCAGACTGTTTTCTACAGTGG - Intergenic
1013885866 6:114966073-114966095 CTGCATTCTCTGTGAAACAGAGG - Intergenic
1013945027 6:115712415-115712437 CTGAAATCTGATTTCAACAGAGG + Intergenic
1014529768 6:122545060-122545082 CGCCAGACTGTTTTCAACAGTGG - Intronic
1014642829 6:123934042-123934064 CTGGAGACTGTGATTAACAGAGG - Intronic
1014841119 6:126221331-126221353 CTCCAGACTGTTTTCCACAGTGG + Intergenic
1015070929 6:129092019-129092041 ATTAAGTCTGTGTACAACAGAGG - Intronic
1016761728 6:147745522-147745544 CAGCAGTCTGTTTTCCAGAGGGG + Intergenic
1016889959 6:148995959-148995981 CTGGAGCCTGTATTCAGCAGGGG + Intronic
1017028400 6:150200518-150200540 CTCCAGTCTCTGCTCAGCAGTGG - Intronic
1017351986 6:153453333-153453355 CTCCAGACTGTTTTCTACAGTGG + Intergenic
1018421513 6:163644244-163644266 CTGCAGGGTGTGTACACCAGTGG + Intergenic
1019658719 7:2211667-2211689 CAGAAGTCTGTGTTCTACAGGGG + Intronic
1019758532 7:2791304-2791326 CTGCTGTCTGTGACCAGCAGTGG + Intronic
1021970530 7:25961234-25961256 CTGCTGTCTGGGGACAACAGGGG - Intergenic
1021989976 7:26131734-26131756 CTGAAGGCTGTGTTCACTAGTGG - Intergenic
1023612246 7:41982739-41982761 CTGCAGTGAGTGTTCATCTGAGG + Intronic
1024252662 7:47518198-47518220 CCTGAGTTTGTGTTCAACAGAGG - Intronic
1025793936 7:64719910-64719932 CTCCAAACTGTGTTCCACAGGGG - Intergenic
1026011656 7:66640923-66640945 CTGAAGTCTGTGTTCATATGAGG + Exonic
1029440163 7:100582936-100582958 CTCCAGTGTGTTTTCAACACGGG + Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030808668 7:113947628-113947650 CTCCACACTGTGTTCAATAGTGG + Intronic
1030823991 7:114132433-114132455 CTGCAGTCTGTGTTCTCATGAGG + Intronic
1030929249 7:115501876-115501898 CTGCATACTGTTTTCCACAGAGG - Intergenic
1031312252 7:120213044-120213066 CTCCAGACTGTTTTCCACAGTGG - Intergenic
1033911616 7:146269951-146269973 CTGCTGTCTTTGTTAAACATGGG + Intronic
1034667390 7:152830346-152830368 CAGCAGTCTGGGTCCAGCAGTGG + Intronic
1034669764 7:152849153-152849175 CTGCAGTCTGTCCTCATCTGGGG - Intronic
1036682805 8:10887847-10887869 CTCCAGCCTGTGTTCACGAGTGG - Intergenic
1037074689 8:14700026-14700048 CTCCAATCTGTTTTCCACAGTGG - Intronic
1038040825 8:23722666-23722688 CTGCAGGCTGTGCTCAACAGTGG - Intergenic
1039241791 8:35565161-35565183 CTCCATACTGTTTTCAACAGAGG + Intronic
1040829341 8:51660401-51660423 CTGGAGACTGTGTTCAACCCAGG - Intronic
1042888700 8:73582724-73582746 CTGCACTTGGTGTTCATCAGTGG - Intronic
1048861407 8:138726930-138726952 CTGCAGTCTGGGGTGACCAGAGG + Intronic
1050475689 9:6038504-6038526 CTCCATTCTGTTTTCAATAGAGG + Intergenic
1050488308 9:6159518-6159540 CTGCATGCTGTTTTCCACAGTGG - Intergenic
1051110831 9:13633588-13633610 CTGCATACTGTTTTCCACAGTGG - Intergenic
1056462971 9:86825978-86826000 CTAAAGTCTCTGTTCCACAGGGG + Intergenic
1056682091 9:88728228-88728250 CTGCAGGGTGGGCTCAACAGGGG + Intergenic
1057656265 9:96955403-96955425 CTACAGCCTTTCTTCAACAGAGG + Intronic
1061862951 9:133477225-133477247 CTGCAGTCCGTGTTCACCCTGGG - Exonic
1185698102 X:2211124-2211146 CTGGAGGCTGTAGTCAACAGAGG - Intergenic
1186049618 X:5576833-5576855 CTGCAGTCTTTGAACCACAGTGG + Intergenic
1187724155 X:22185193-22185215 CTGCAGTCTGTGTTTGAGAAAGG - Intronic
1187853491 X:23614175-23614197 CTGCATACTGTTTTCCACAGTGG - Intergenic
1192374578 X:70546781-70546803 CTGCAGTCTGTTTGCCAAAGTGG - Intronic
1193550383 X:82885147-82885169 CTGCAGACTGCGTTCCACAATGG - Intergenic
1194869391 X:99109516-99109538 CTCCAAACTGTGTTCCACAGTGG - Intergenic
1197836849 X:130703947-130703969 ATACAGTAAGTGTTCAACAGAGG - Intronic
1198511762 X:137359133-137359155 CTGAAGTCTGTCTTCCCCAGAGG + Intergenic
1198948045 X:142037619-142037641 TTGCAGTCTGTGTTCTTCAAAGG + Intergenic
1200236676 X:154471089-154471111 CGGCAGGCTGTGGACAACAGAGG - Exonic
1200732584 Y:6758501-6758523 CAGCAGTCTGAGATCAACATGGG - Intergenic
1200783016 Y:7233813-7233835 CTCCAGACTGTTTTCCACAGTGG - Intergenic