ID: 932059848

View in Genome Browser
Species Human (GRCh38)
Location 2:68485259-68485281
Sequence CTGATGTCATTAAAGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932059848_932059849 -5 Left 932059848 2:68485259-68485281 CCTTTTGTCTTTAATGACATCAG 0: 1
1: 0
2: 1
3: 27
4: 322
Right 932059849 2:68485277-68485299 ATCAGTGCTTCTGTGAGTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932059848 Original CRISPR CTGATGTCATTAAAGACAAA AGG (reversed) Intronic
902374610 1:16024446-16024468 CTAAAGACATTAAAGACTAAAGG - Intronic
906857769 1:49326998-49327020 CTGATGACCTTAAAGATAGAAGG - Intronic
907786471 1:57617819-57617841 CTCCTGCCATAAAAGACAAAAGG + Intronic
908497772 1:64712261-64712283 CTGATGTAATTTAGGACAGAGGG - Intergenic
909855584 1:80525905-80525927 CTGATTTTATTAAATACAACTGG + Intergenic
910261210 1:85295446-85295468 CTAATGACAGAAAAGACAAATGG + Intergenic
910365019 1:86455754-86455776 GTAATGTCTTTAAAGGCAAAGGG + Exonic
910662299 1:89686856-89686878 CTGATGTCACTAACATCAAAGGG + Intronic
911366091 1:96939114-96939136 ATGATTTCATGAAAGAAAAAGGG - Intergenic
911463889 1:98226769-98226791 CTAATGTCAGGAATGACAAAGGG + Intergenic
913340036 1:117749506-117749528 CTGATGTCAATATAGAGACATGG - Intergenic
917174659 1:172220142-172220164 ATGATGTCATTGAAGAGAAAGGG + Intronic
917188484 1:172388433-172388455 TTCATGTCATGAAAGTCAAAGGG - Intronic
917982093 1:180276112-180276134 CTGATCTCATTTAAGAGAATGGG - Exonic
918266786 1:182849991-182850013 CTGATGAAATTAAAAAAAAAAGG - Intronic
919359105 1:196568151-196568173 CTAGTTTCATGAAAGACAAATGG + Intronic
919424625 1:197414733-197414755 CTGTTGTCAATCAAGATAAAAGG - Intronic
921059205 1:211568411-211568433 CTTATGTAATTAAAAATAAATGG + Intergenic
921104385 1:211961111-211961133 CTGATGTCCTGAAAGAGATAGGG + Intronic
921437683 1:215145122-215145144 CTGATGTCAATAAAAAATAATGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921656153 1:217739637-217739659 ATGATCTCATTAAAAATAAAAGG - Intronic
922318977 1:224467973-224467995 CTGATTTTTTTAAAGAAAAAAGG - Intronic
922664237 1:227455127-227455149 CTGTTGTCATCCAAGACAACTGG - Intergenic
923399142 1:233599557-233599579 GTGAAGTCATTTAAGAAAAAAGG + Intergenic
924799711 1:247319545-247319567 GTAATGACATTAAATACAAATGG + Intronic
1062854879 10:774994-775016 CTGTTATCTTTAAAGACACAGGG - Intergenic
1063813222 10:9738772-9738794 TTGATGACATTAAACAGAAATGG - Intergenic
1064728881 10:18308844-18308866 CTGATGACATTTGATACAAAAGG - Intronic
1065678444 10:28204106-28204128 CTCATGTGTTTAAAAACAAATGG + Intronic
1065836296 10:29661217-29661239 CTGGTTTGCTTAAAGACAAAGGG + Intronic
1068081890 10:52329240-52329262 CTGATGTCCTTAATGTCACATGG + Intergenic
1068191472 10:53657888-53657910 CTGATATTTTTCAAGACAAATGG - Intergenic
1068574605 10:58671104-58671126 ATGATCTCATTAAAGAGACAAGG - Intronic
1069684118 10:70306408-70306430 TCAATGTCATAAAAGACAAAGGG - Intronic
1071584445 10:86806018-86806040 TTGATGTCATGAAACACAACAGG - Intronic
1073721689 10:106179985-106180007 TTGATGTCATTAAGAACAAACGG - Intergenic
1073785216 10:106881671-106881693 CTAATGTCACTAGAGACCAACGG + Intronic
1073809200 10:107134178-107134200 CTGATGTCAGGAAGGAAAAAAGG + Intronic
1073939394 10:108677698-108677720 CTGATGTCCTTAAAAAAAAACGG + Intergenic
1074094865 10:110302744-110302766 CTGGTGTCCTGAAACACAAAAGG + Intronic
1074700460 10:116087687-116087709 CTGGTGTCGGTAAAGACAAGTGG - Intronic
1074779732 10:116792889-116792911 CTGATGACTAAAAAGACAAAGGG + Intergenic
1075189249 10:120291280-120291302 CTGGTGACCTTAAAGAAAAATGG + Intergenic
1075853890 10:125611437-125611459 CTGTTGTCATCAAAGACACATGG - Intronic
1076284104 10:129276762-129276784 AGGATGTCACAAAAGACAAAAGG + Intergenic
1078406743 11:11076683-11076705 CAGCTTTAATTAAAGACAAATGG - Intergenic
1078987446 11:16609551-16609573 ATGAAGTGATCAAAGACAAAGGG + Intronic
1079809811 11:24983200-24983222 TTGATGTGATTAAACTCAAAGGG - Exonic
1079966462 11:26986126-26986148 CTGAGGTTATTAAAGAAGAATGG - Intergenic
1080779084 11:35414327-35414349 ATGATGTCAGAAAAGACAATGGG - Intronic
1081432750 11:42994514-42994536 CTGATGACATTAAAGAATAATGG - Intergenic
1084904452 11:72335063-72335085 CTGAAGGAATTCAAGACAAATGG - Intronic
1085241160 11:75057395-75057417 CTGAAGTCATTCAAGCCCAAAGG - Intergenic
1085840381 11:80004884-80004906 CTGATGTCCTTAAAAAAAAGAGG - Intergenic
1086201329 11:84205943-84205965 CTGATTTTTTTAAAGACAGATGG + Intronic
1086941780 11:92805657-92805679 CTGATATCATAAAAGAGAAATGG + Intronic
1087042276 11:93813295-93813317 GTGTTTTCATTAAAGAAAAATGG + Exonic
1088170849 11:106994824-106994846 TTCATTCCATTAAAGACAAAAGG - Intronic
1088384288 11:109235799-109235821 CTCATCTAATTAAAAACAAATGG - Intergenic
1088412813 11:109554043-109554065 CTGATTTCTTTAAAGAAAACTGG - Intergenic
1093079587 12:14794247-14794269 CTGATGACAATAAAGCTAAAAGG + Intronic
1093254815 12:16853990-16854012 CTGAAAACATAAAAGACAAAAGG + Intergenic
1093820265 12:23607957-23607979 CTGATGACACTAAACATAAAAGG + Intronic
1095279694 12:40335637-40335659 CTGTGGTCTTTGAAGACAAAAGG + Intronic
1095666588 12:44808740-44808762 CTAATGTCAAGAAAGAAAAATGG + Intronic
1099095058 12:78364988-78365010 ATGCTGTTATTAAAGATAAAAGG - Intergenic
1103690442 12:122768893-122768915 TTGATGTCATTCAGGAAAAATGG + Exonic
1106559775 13:30838256-30838278 ATGATGACATAAAAGACCAATGG + Intergenic
1107014811 13:35699648-35699670 GTGTTGTCATTAAGGAAAAAGGG - Intergenic
1109720096 13:66264994-66265016 CAGATCTCATTAAAGAAAGAAGG - Intergenic
1110068118 13:71134717-71134739 CTGATGTCCTTACAGAAAGAAGG - Intergenic
1110261614 13:73491434-73491456 CTGGTGTCATGAAAGTCAGAAGG + Intergenic
1110261878 13:73494030-73494052 CTGAGTTAATTAAATACAAATGG - Intergenic
1111346799 13:86967433-86967455 CACATGTCATTAAAAACACAGGG + Intergenic
1111413538 13:87909705-87909727 ATGATGTCCTTAAAGAAAAAGGG + Intergenic
1111497087 13:89065483-89065505 CTCATAACATTTAAGACAAAAGG + Intergenic
1111683056 13:91467635-91467657 CAGATGTTACTAAAAACAAAAGG - Intronic
1113034231 13:106031357-106031379 CTGATGTCATGATAGCCCAACGG - Intergenic
1113139882 13:107135442-107135464 GTGATGTTATTAAGGACAGAAGG - Intergenic
1113295382 13:108954264-108954286 CTGTTTTCATTAGAGTCAAAGGG - Intronic
1113383101 13:109821411-109821433 CTGATGTTATGAAAAACAAAGGG - Intergenic
1114071463 14:19112089-19112111 CAGATGTCTTTACTGACAAATGG + Intergenic
1114090799 14:19287879-19287901 CAGATGTCTTTACTGACAAATGG - Intergenic
1116572572 14:46536129-46536151 TTGATCTGATTAAATACAAAAGG - Intergenic
1116683374 14:48006884-48006906 CTGTGGTCATTAAAGCCAGAGGG + Intergenic
1117804187 14:59473523-59473545 GTGATGCCATTAAACACAATGGG + Intronic
1118079898 14:62346753-62346775 CTGAATTCATTTAATACAAAAGG + Intergenic
1119245017 14:73097133-73097155 GTGATATCATAAAAAACAAACGG - Intronic
1122799045 14:104220791-104220813 CCCATGTCCTCAAAGACAAAGGG - Intergenic
1202893314 14_KI270722v1_random:180264-180286 CAGATGCCAATAAAGACCAAGGG - Intergenic
1124627925 15:31319947-31319969 TTGCTGGCTTTAAAGACAAAGGG - Intergenic
1124687431 15:31794256-31794278 CTGATGTAAATACAGACAAATGG - Intronic
1125324235 15:38520067-38520089 CACATGTCTTTAAAGATAAATGG + Intronic
1126380384 15:48040560-48040582 CTGTTGTCTCTAAAGACAACAGG - Intergenic
1126806648 15:52356848-52356870 CTGAATTCATGAAAGACCAAAGG - Intronic
1127018729 15:54720341-54720363 TTAATTTCATTAAAGGCAAAGGG - Intergenic
1127153656 15:56105839-56105861 CTCATGTTTTTAAAGAAAAAAGG + Intronic
1127204777 15:56703946-56703968 CAGATGTCAGAAAAGAGAAATGG - Intronic
1128449234 15:67792826-67792848 CTGAATTCATTAAAGACATACGG - Intronic
1130817206 15:87449622-87449644 GTGATGTGATTTAAGACACAGGG + Intergenic
1131387507 15:92019337-92019359 CTGATTTCATGAAAGTCATAGGG + Intronic
1133571621 16:7046133-7046155 CTGATGCAATTAAAGACTGAGGG - Intronic
1136109333 16:28054815-28054837 CAGATGTCTTTAAAAAAAAATGG + Intronic
1140290879 16:73655516-73655538 CTGATTACATTAACGTCAAAAGG + Intergenic
1140345964 16:74213348-74213370 GTGATGTCACAAAAGCCAAAGGG + Intergenic
1141404575 16:83780919-83780941 CTGCTGTCATAAAAGACTAAAGG + Intronic
1143804506 17:9415231-9415253 CTGATGTGTTTAAAGGCAGAAGG - Intronic
1144508985 17:15858994-15859016 CTGATTTTTTTAAAGACATAGGG + Intergenic
1145173101 17:20676634-20676656 CTGATTTTTTTAAAGACATAGGG + Intergenic
1147126435 17:38372804-38372826 CTGTTGTAATAAAAGAAAAAAGG + Intronic
1147268817 17:39252225-39252247 CTGAGGTCATACAAGATAAATGG + Intergenic
1148392006 17:47279488-47279510 CTGATGTCAGCAACCACAAAGGG + Intronic
1149303151 17:55324135-55324157 CTGTTGTATTTGAAGACAAAAGG - Exonic
1149653369 17:58293268-58293290 CTGGTGTCATTTCAGAGAAATGG - Intergenic
1150327552 17:64268991-64269013 CTGAGGTTATTAAATATAAATGG + Intergenic
1150648685 17:66995888-66995910 CTGATGGCAATAAGGAAAAATGG - Intronic
1150782153 17:68132989-68133011 CTGAAGTCTTTAATGGCAAAGGG - Intergenic
1150934566 17:69621446-69621468 CTGATGAGATTACAGAGAAAAGG - Intergenic
1152998264 18:428811-428833 CTGATGTAATTGAATCCAAAGGG - Intronic
1153097805 18:1428027-1428049 TTGGTGTCATTCAAGACAAAGGG + Intergenic
1154496990 18:14968928-14968950 CTGATAGCTTTAAAAACAAATGG - Intergenic
1155060489 18:22223915-22223937 CTGATGTCATCAAAGCCCCAGGG + Intergenic
1155130502 18:22929941-22929963 CTGATATCACTAAAGTCATATGG - Intronic
1156079079 18:33313356-33313378 CTTATGTCAAAACAGACAAAGGG + Intronic
1156973081 18:43181719-43181741 CAGATATAATTAAAGGCAAAAGG + Intergenic
1157097021 18:44695047-44695069 GTGAAGTCAATAAAGGCAAAGGG + Intronic
1159149488 18:64503063-64503085 CCCATGTCATTAAATGCAAATGG + Intergenic
1161921020 19:7265995-7266017 CTGAGGTACTAAAAGACAAATGG + Intronic
1164515977 19:28935782-28935804 CTTATGTAACTAAAGACCAAGGG - Intergenic
1165181382 19:33974474-33974496 ATGATGTGATTAAAGCCAAATGG + Intergenic
1165185486 19:34017191-34017213 CTGCTGTCATACAGGACAAATGG - Intergenic
1166600150 19:44086626-44086648 CTGATGTCTTGAAAGACATGAGG - Exonic
925734195 2:6946010-6946032 GTGATGTGATTCAAAACAAAAGG + Intronic
925953706 2:8939691-8939713 CTGAGGTCAGAAAAGACACATGG + Intronic
926064905 2:9830851-9830873 CTGTTGTCATTAAACAGTAAAGG - Intergenic
926622709 2:15061544-15061566 CTGATGTCATCAAGGTCACAGGG + Intergenic
926692915 2:15749544-15749566 ATGATTTCCTTAAAGACAATTGG + Intergenic
928369684 2:30731973-30731995 TAGATTTCATTAAAAACAAAGGG + Intronic
928862943 2:35881692-35881714 CTGCTGTCATGAGAGATAAATGG + Intergenic
929176463 2:38982160-38982182 CTATTTTCATTAAAGGCAAAAGG + Exonic
929183242 2:39066384-39066406 TTGAAGTCATTAAAGTCAAACGG + Intronic
931372255 2:61674461-61674483 CTGATGACAGTATAGAGAAAGGG + Intergenic
931390641 2:61840532-61840554 ATGATGTCATTAATGAGACAGGG + Exonic
931927076 2:67085339-67085361 CTGAGGTCATGAGAGAAAAATGG - Intergenic
931947993 2:67332265-67332287 CTGAAATGATTAAACACAAAGGG - Intergenic
931993454 2:67815196-67815218 CTCATGTAATTAAAGAAGAATGG + Intergenic
932059848 2:68485259-68485281 CTGATGTCATTAAAGACAAAAGG - Intronic
932167316 2:69520179-69520201 CTTATTTCTTTAAAGGCAAAGGG + Intronic
932195443 2:69779156-69779178 CTTATTTCATTAAAAAAAAAAGG - Intronic
932961811 2:76421166-76421188 GTGATGTCATGAAAACCAAAAGG - Intergenic
936497069 2:113031634-113031656 CTGACCTCATCAAAGACAATAGG - Intronic
936727565 2:115339287-115339309 TTGATGTCATTAAAAAAAAATGG - Intronic
937652138 2:124331081-124331103 CTGTTGTCTTTAAAGATATATGG - Intronic
937652140 2:124331121-124331143 GTGTTGTCATTAAGGACATATGG - Intronic
939144339 2:138394597-138394619 CTGCTGTTATTAAAAACAAGAGG + Intergenic
940557026 2:155242031-155242053 CTGATCTCAGTAGATACAAAAGG + Intergenic
941101827 2:161305223-161305245 TTGATGCCATGAAAGCCAAAAGG - Intergenic
943338449 2:186647097-186647119 CTCATTTCATTAAAGACTACAGG - Intronic
943535448 2:189143396-189143418 CTAATGTTATTTCAGACAAAAGG + Intronic
945552974 2:211243993-211244015 CTGATTTCATCAAAGGCAGATGG - Intergenic
946269321 2:218577369-218577391 CTGCTGTCATTCTAGCCAAAAGG - Intronic
946567575 2:220983965-220983987 CTTATGTCATTAAATACCAGTGG - Intergenic
947313085 2:228825547-228825569 CTGATGACATTCAAGAGAGAAGG + Intergenic
947976617 2:234371944-234371966 CTGATGCCATTACAGGTAAATGG - Intergenic
1170695559 20:18654894-18654916 TTGATGCTTTTAAAGACAAAGGG - Intronic
1170752045 20:19158171-19158193 CTAATGTCAGGAAAGAAAAAGGG - Intergenic
1175755162 20:61525081-61525103 CTGTTGTCATTAAGCTCAAATGG + Intronic
1176276696 20:64276098-64276120 ATGATGTTAATAAAGAAAAAAGG - Exonic
1177747193 21:25231832-25231854 CTGATTTCAGTATAGTCAAAAGG - Intergenic
1177828147 21:26106769-26106791 TTGAGGTCATTGAAGACAAAAGG - Intronic
1178107905 21:29341209-29341231 TTTATGTCATAAAAGACTAAAGG + Intronic
1178276257 21:31240351-31240373 CTGCATTTATTAAAGACAAATGG + Intronic
1180165472 21:46023540-46023562 CTGATGTGAGCAAAGAAAAAAGG + Intergenic
1180489907 22:15834421-15834443 CAGATGTCTTTACTGACAAATGG + Intergenic
1181429044 22:22866549-22866571 CTGATGTCATTCATGAAAATTGG + Intronic
1182045157 22:27268465-27268487 CTGCTCTCATTAAGGTCAAAAGG - Intergenic
1182738358 22:32547291-32547313 CAGATGGCATTAAAAGCAAAAGG - Intronic
1183333907 22:37235946-37235968 CTCATGTGATCCAAGACAAAAGG + Intronic
949488552 3:4565062-4565084 CAGATGTTATTAAATAAAAAAGG - Intronic
949507622 3:4741970-4741992 CTGTTGGCATTAAAGAAAGAGGG + Intronic
949774387 3:7615469-7615491 GTGATGTGATTAAAAAGAAACGG - Intronic
951166388 3:19488593-19488615 CTGAGGTCATCCAAGAAAAAGGG - Intronic
953807948 3:46087852-46087874 CCGATGTCATGAAAAACACAGGG + Intergenic
955053544 3:55435655-55435677 CTGATGTCATTAATCACCAGTGG - Intergenic
955215051 3:56978231-56978253 CAGAAGTCTTTAAAGTCAAATGG + Intronic
956040019 3:65135805-65135827 CTGAAGTCAGTTAAGACAGATGG + Intergenic
956574195 3:70733333-70733355 ATGAAGTCATTTAAGAAAAATGG - Intergenic
956689589 3:71863653-71863675 CTTATGTCATTAAAAAAAGAGGG + Intergenic
956906653 3:73772804-73772826 CTGATGTCTCTGAAGATAAAAGG + Intergenic
957131562 3:76229625-76229647 CTGATGTGAATATAGAGAAAGGG - Intronic
957228115 3:77475126-77475148 ATGATATCACTAAACACAAATGG + Intronic
957784093 3:84858286-84858308 GTGATGTAATTACAGCCAAATGG - Intergenic
958558771 3:95715328-95715350 ATCATGCCATTAAAGACAAAAGG + Intergenic
958800151 3:98745510-98745532 CTGAGGACATTAAAGACCAAAGG - Intronic
960399869 3:117183261-117183283 CTGATTTCATTAAAGGCCATGGG + Intergenic
960879195 3:122328003-122328025 CTGATGACATTGGAGCCAAAGGG - Intronic
964020065 3:151999269-151999291 CAGATGTATTTAAAGAAAAAGGG + Intergenic
964225952 3:154402202-154402224 CTGATGTCCTTAAAGCAAATGGG + Intronic
964333440 3:155629182-155629204 CTGATGTCATTCAGAAAAAATGG - Intronic
964596237 3:158433444-158433466 CTCATGTCATGAAATGCAAAAGG + Intronic
965144010 3:164874607-164874629 TTTATTTCATTAAAGATAAAAGG + Intergenic
965507004 3:169527561-169527583 ATGATGCCATTAAAAACATATGG - Intronic
965884036 3:173422789-173422811 CTGATGTAAAAACAGACAAATGG - Intronic
965906444 3:173712983-173713005 ATGATATACTTAAAGACAAAGGG + Intronic
966160986 3:176968154-176968176 CTCCTGTCAGGAAAGACAAAAGG + Intergenic
966238581 3:177729571-177729593 ATGATGTCACTAAAGACCAAAGG + Intergenic
967308386 3:188082156-188082178 CTGATGTCATCTCAGCCAAAGGG + Intergenic
967684507 3:192404392-192404414 CGGAAGTTATTACAGACAAAGGG - Intronic
968738605 4:2314382-2314404 GTGATTACATTAAATACAAATGG - Intronic
970545452 4:17125612-17125634 CTCATGTCAGTATAGACAAAGGG - Intergenic
970839980 4:20456927-20456949 CTGATTTCATTAAAGATATTTGG + Intronic
972802860 4:42495763-42495785 GTGAAGTCATTAAAAACACATGG + Intronic
975032319 4:69636119-69636141 CTGATGTCCTTCAAGACATTTGG + Intronic
975099708 4:70498818-70498840 CTCATGTCTTTAAACAGAAATGG + Intergenic
975471696 4:74776443-74776465 CTCATAAAATTAAAGACAAAAGG + Intronic
975568393 4:75785660-75785682 ATGATGTAAATAAAGAAAAAGGG - Intronic
975776764 4:77795988-77796010 CTGAAATTATTAAAGATAAAAGG - Intronic
976055679 4:81062667-81062689 CTGATGACATTAGAAGCAAAGGG - Intergenic
977890469 4:102304993-102305015 AAGATGTTATTAAAGACATATGG - Exonic
979896130 4:126159726-126159748 TTGATGTCATTCAAGATACAAGG - Intergenic
980701091 4:136431596-136431618 ATAATTTCATTAAATACAAATGG + Intergenic
980953924 4:139409223-139409245 CTGATGTCCTTAAACATGAAAGG - Intronic
981391735 4:144198658-144198680 CAGATGTCATTAAAGACATTTGG - Intergenic
982196991 4:152926489-152926511 CTGATGTGATGAAAAAAAAAGGG + Intergenic
982423722 4:155230313-155230335 CTGATTTTTTTAAAGAAAAAAGG - Intergenic
982664780 4:158248846-158248868 CTGATGGCATTAAAACTAAATGG - Intronic
983408061 4:167356851-167356873 CTGATATCAATATAGACAATTGG - Intergenic
985184402 4:187300248-187300270 CTGATGTCATAACAGAAAACCGG + Intergenic
985306790 4:188551703-188551725 CTGATCTCATTAACTTCAAATGG + Intergenic
986997390 5:13622688-13622710 CTGACATTATTAAACACAAATGG - Intergenic
987000494 5:13655264-13655286 CTGATCGCATTGAAGACCAAGGG + Intergenic
987270334 5:16301646-16301668 CCAAGGTCATAAAAGACAAAGGG + Intergenic
987345109 5:16972121-16972143 CAGATGTCATTAAAGTTAGAAGG + Intergenic
987389730 5:17364494-17364516 CTGATTTCAGAAAAGAGAAAAGG + Intergenic
987719203 5:21613049-21613071 CTCAAGTCTTTAAAGAAAAAAGG + Intergenic
987895073 5:23934066-23934088 CTGATGTCCTTATAGGAAAAAGG + Intergenic
988371509 5:30375021-30375043 CTAATTTTATTAAATACAAATGG + Intergenic
988693742 5:33598104-33598126 CAGATGTCATCAAGGGCAAAAGG + Intronic
991605705 5:68398553-68398575 TTGATGGCCTTAAAGACAGAAGG + Intergenic
993311184 5:86334635-86334657 TTTATGTCATTGAGGACAAAAGG - Intergenic
993340229 5:86716439-86716461 CTGCTGACAGAAAAGACAAAGGG - Intergenic
993922298 5:93820766-93820788 ATTTAGTCATTAAAGACAAAAGG - Intronic
994552603 5:101256649-101256671 CTGAAGGCATTCAAGAGAAAAGG + Intergenic
995480054 5:112584438-112584460 CTGTTGTCACTAAAGGGAAATGG - Intergenic
995719081 5:115110917-115110939 CTCGTATCATCAAAGACAAAGGG + Intergenic
996140130 5:119896963-119896985 CTGCTGTCTTTGAAGACAGAAGG - Intergenic
997175572 5:131772855-131772877 TTGATGTCATGACAGAAAAATGG - Intronic
1000250009 5:159485362-159485384 ATGATGTTATTAAAAAGAAAGGG - Intergenic
1000927224 5:167208799-167208821 CTGATGTCATTTTAGACATTGGG - Intergenic
1001563485 5:172684985-172685007 CTGATTTCAATAGAGTCAAAGGG - Intronic
1003106581 6:3221326-3221348 GTGACCTCATTACAGACAAAAGG + Intergenic
1003741639 6:8947106-8947128 CAGATGTCATCACAAACAAAAGG - Intergenic
1004963208 6:20816132-20816154 CTGTTGTCCTTAAAAAAAAAAGG - Intronic
1005130669 6:22503940-22503962 CTTATGTCAATAGAGAGAAATGG - Intergenic
1006524217 6:34589975-34589997 CTGATGCCATTAAAAACAAATGG + Exonic
1007185165 6:39964702-39964724 CTTAAGTCAATAAAGATAAAAGG + Intergenic
1007526078 6:42494736-42494758 CTGACATCATTAAAGACCCAAGG - Intergenic
1007623369 6:43228515-43228537 CTGATGTCTTCACAGAAAAAGGG + Intronic
1007635210 6:43295785-43295807 CTGATGTCATTGAAGAATGATGG - Intronic
1008129314 6:47702319-47702341 CTGGTCTCATAAAAGCCAAAGGG - Intronic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009749392 6:67863863-67863885 CTGATGTCAAATAAGAAAAATGG - Intergenic
1009850867 6:69196550-69196572 CTGGTGTCCTTATAGAAAAAAGG - Intronic
1012376909 6:98573180-98573202 ATAATGTCATTAGTGACAAACGG + Intergenic
1013459378 6:110359976-110359998 ATGTTGTCATGAAAAACAAAAGG + Intergenic
1014341593 6:120214956-120214978 GTGATGACCTTAAAGATAAATGG + Intergenic
1014993571 6:128113146-128113168 CTGGTGTAATTAGAAACAAAGGG - Intronic
1015155328 6:130088580-130088602 CAGATGACATTGAAGAAAAATGG + Intronic
1015518360 6:134107366-134107388 TTGCTGCCTTTAAAGACAAAGGG - Intergenic
1015772850 6:136786725-136786747 CTGATGTCTTTAAAAAGAATAGG - Intronic
1016027659 6:139304423-139304445 CAGATGTCTTTAGAGATAAATGG + Intergenic
1017911752 6:158799132-158799154 TTGAAGTCATTTAAGACATATGG + Intronic
1018555667 6:165048390-165048412 TTGATGTCAGGAAAGACACAAGG - Intergenic
1018780797 6:167063592-167063614 CTTATGTCACTAAAGGAAAAAGG + Intergenic
1019190372 6:170247403-170247425 CTGATGTCATCAATCACACACGG - Intergenic
1020674389 7:11163401-11163423 CTTATTTCATTTAATACAAAAGG - Intronic
1021913832 7:25411960-25411982 CTGATGTAATGAAAGACCACAGG + Intergenic
1023465246 7:40447557-40447579 CTTATGTCATTATAGAAGAAGGG + Intronic
1023590072 7:41772170-41772192 CTGATGCTGTTAAAGAAAAAAGG + Intergenic
1023909718 7:44544967-44544989 CTGATGGCAAGAAAGACAAAGGG - Intergenic
1024318721 7:48044680-48044702 GGGTTCTCATTAAAGACAAAAGG + Intronic
1024391739 7:48821390-48821412 CTGATGTATGAAAAGACAAAAGG + Intergenic
1024829624 7:53434998-53435020 CTCATGTATTTAAAGTCAAAGGG - Intergenic
1025015032 7:55432570-55432592 CTTGTGTCATGAAAGACAAGAGG + Exonic
1025582834 7:62741913-62741935 CCAATATCATCAAAGACAAAAGG - Intergenic
1026403737 7:70043168-70043190 CTGATGTCATTATGCATAAATGG + Intronic
1027567397 7:79813685-79813707 CTGGCTTCATTAAAGACAAAAGG - Intergenic
1027606092 7:80300698-80300720 CTTATGTCAAGAAAGAGAAAGGG + Intergenic
1027737063 7:81945898-81945920 CTGAGGTCTTTAAAGAAACATGG + Intergenic
1027784432 7:82562676-82562698 CTGATGTCACTAAGTACAAAGGG + Intergenic
1027793118 7:82657885-82657907 CTGAAGTCACTAAAGGCTAAAGG + Intergenic
1028095129 7:86751085-86751107 CTGATGCCATTTCAGACAATGGG - Intronic
1028417209 7:90594150-90594172 CTGATCTCATTTAAGAAAATTGG + Intronic
1030054568 7:105571854-105571876 TTTATATCATTAAAGAAAAATGG - Intronic
1031318138 7:120283308-120283330 CTGATTTCATTTAAGATGAAAGG + Intronic
1033388087 7:140898677-140898699 TGGATGTGATTAAGGACAAATGG - Intronic
1034921505 7:155087178-155087200 CTGATGTCAATACAGACTCAGGG - Intergenic
1036114523 8:5944406-5944428 CATATTTCATTAAAGACAGATGG + Intergenic
1038049878 8:23798532-23798554 CTGATGTCATTCAAGAAAGCAGG - Intergenic
1038779482 8:30557820-30557842 TGGATGCCGTTAAAGACAAACGG + Intronic
1039173358 8:34774551-34774573 GTGCTTTCAGTAAAGACAAATGG + Intergenic
1039474285 8:37831307-37831329 CTTGTTTCATTAAAGAAAAAAGG + Intronic
1040752264 8:50725240-50725262 CTGATTGCATAAAAGCCAAATGG - Intronic
1041475151 8:58256812-58256834 TTGGTGTCTTTTAAGACAAAAGG + Intergenic
1042260035 8:66849307-66849329 GTGATGTCCTTTAATACAAAAGG - Intronic
1042966437 8:74358453-74358475 CTGGTATCCTCAAAGACAAAGGG - Intronic
1043747467 8:83892996-83893018 CAAATATCATTAAAGACCAAAGG + Intergenic
1045543785 8:103110470-103110492 CTGATGTCATGTAAGACACTAGG + Intergenic
1045638025 8:104215027-104215049 CTAAAGTTATTAAAGACCAAAGG - Intronic
1046750492 8:117921600-117921622 CTGATGTCCATACAGATAAAAGG + Intronic
1048407127 8:134135186-134135208 GTGATGTAATGAAAAACAAATGG + Intergenic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1050978843 9:11980942-11980964 TTGATGTTCTTAAAGACCAATGG + Intergenic
1051221837 9:14857185-14857207 CTGATTTCAAGAAGGACAAAAGG + Intronic
1051689767 9:19698573-19698595 CTGAAGTCATTAAAGATGAAGGG - Intronic
1053263895 9:36696438-36696460 ATGATGTCGCTAAAGACCAAAGG + Intergenic
1053314397 9:37039220-37039242 CTGAAGTTATTACAGAAAAATGG - Intergenic
1055396895 9:75885386-75885408 CTAATGTGATTCAAGAAAAAGGG - Intergenic
1055504179 9:76931251-76931273 ATGATTTCATGCAAGACAAAGGG + Intergenic
1056927264 9:90845563-90845585 CTGATAGGATCAAAGACAAATGG + Exonic
1057289540 9:93794872-93794894 CTGATGACAACAAATACAAAAGG - Intergenic
1058579437 9:106439203-106439225 CAGATGTCATCAAGGACAATAGG + Intergenic
1059813680 9:117886805-117886827 CTCATTTCATAAAAGACACATGG + Intergenic
1060376995 9:123124575-123124597 CTGATGTAATTGAAGAGGAAAGG + Exonic
1203490505 Un_GL000224v1:100406-100428 CAGATGCCAATAAAGACCAAGGG - Intergenic
1203503128 Un_KI270741v1:42285-42307 CAGATGCCAATAAAGACCAAGGG - Intergenic
1185951309 X:4437498-4437520 CTGATGTTAATAATGAAAAAGGG + Intergenic
1187047255 X:15659457-15659479 CTGATGTTAATAAAGGCAACTGG - Intronic
1187242632 X:17527653-17527675 CTGAAGTGATTAAAGCAAAAGGG - Intronic
1187811252 X:23179832-23179854 CTGCTGTCATTAAAAACAAGTGG + Intergenic
1189258585 X:39660106-39660128 CAGATATCATAAAGGACAAAGGG - Intergenic
1190196045 X:48319319-48319341 CTGATAACATTAAAGAATAAGGG - Intergenic
1190209053 X:48429836-48429858 CTGATAACATTAAAGAATAAGGG - Intergenic
1190662746 X:52669672-52669694 CTGATAACATTAAAGAATAAGGG - Intronic
1190676684 X:52788811-52788833 CTGATAACATTAAAGAATAAGGG + Intronic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1193748135 X:85309023-85309045 CTTATTTCTTTAAAGAAAAATGG + Intronic
1194351892 X:92831030-92831052 CTGGTGTCATAAATGTCAAATGG + Intergenic
1194445768 X:93986067-93986089 TTGATGTCATTCCAGAAAAAAGG - Intergenic
1194574002 X:95589082-95589104 TTGAATTCTTTAAAGACAAATGG - Intergenic
1195022178 X:100840284-100840306 CTGTTGTCATTAGAGATGAATGG + Intronic
1195698898 X:107687056-107687078 CTGAACTTATTAAAGACACAGGG - Intergenic
1196804750 X:119574411-119574433 CTTATGTCATTAAAGCCCCACGG - Intergenic
1198665546 X:139018364-139018386 CAGCTTGCATTAAAGACAAATGG + Intronic
1199467137 X:148151012-148151034 CTGTTGCCACTAAAGGCAAATGG + Intergenic
1200041915 X:153376757-153376779 CTGCTGGCTTTAAAGACAGAGGG + Intergenic
1200163707 X:154021944-154021966 CTGATATATTTAAAAACAAAAGG - Intronic
1200408638 Y:2840236-2840258 TTGATGTCGTAAGAGACAAATGG - Intergenic
1200660201 Y:5947722-5947744 CTGGTGTCATAAATGTCAAATGG + Intergenic
1201730682 Y:17199454-17199476 CTGATATCATTAAATGCGAATGG + Intergenic