ID: 932061277

View in Genome Browser
Species Human (GRCh38)
Location 2:68501050-68501072
Sequence TACACAAGATTGCATAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932061277_932061278 0 Left 932061277 2:68501050-68501072 CCATTCTTATGCAATCTTGTGTA 0: 1
1: 0
2: 0
3: 13
4: 210
Right 932061278 2:68501073-68501095 TAGTTTGACTAATAAAATAATGG 0: 1
1: 0
2: 5
3: 39
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932061277 Original CRISPR TACACAAGATTGCATAAGAA TGG (reversed) Intronic
906003786 1:42450554-42450576 GACACAAGCTAGCAGAAGAAAGG - Intronic
906422804 1:45685530-45685552 TCCAAAAGTTTACATAAGAATGG - Intronic
910101797 1:83585112-83585134 TGCAGAAGCTTGCAAAAGAAGGG + Intergenic
910375431 1:86564081-86564103 TACACAAGAATGCACAAACATGG + Intronic
910380114 1:86617437-86617459 AACACAAGACTGTATAAGACTGG + Intergenic
912362313 1:109104979-109105001 TAAAAAAGATTGGACAAGAATGG - Intergenic
914044725 1:144081620-144081642 TACTCAAGAATGCATAAAAGAGG + Intergenic
914133385 1:144879066-144879088 TACTCAAGAATGCATAAAAGAGG - Intergenic
914524890 1:148456842-148456864 TACACTAGATTACATATAAAAGG + Intergenic
915965436 1:160303585-160303607 TACAGAAGAATACAGAAGAATGG + Intronic
916967016 1:169958068-169958090 GACACCAGATTGCCTAAGGAAGG - Intronic
918265548 1:182838934-182838956 TACATGAGATGGCATATGAAGGG - Intergenic
921720454 1:218465043-218465065 TACCCTAGAATGCATGAGAAAGG + Intergenic
922108512 1:222533637-222533659 TGCACAAGATAGAATAATAATGG + Intronic
922538812 1:226403552-226403574 TACACAGGATGGCTTATGAAAGG - Intronic
923984263 1:239363061-239363083 TACTCAAGATAGCATTATAATGG + Intergenic
924764904 1:247023325-247023347 TACACAATATTTCATAAGTGCGG - Intergenic
1064733038 10:18352541-18352563 TAAACAAGAGTGCTTAAAAATGG - Intronic
1069187886 10:65449532-65449554 AACACAAGATTGAGTAATAAAGG + Intergenic
1069984093 10:72272328-72272350 GACACCAGATTGCTTAACAATGG - Intergenic
1071032283 10:81198598-81198620 TTCAAAAGATTTCATTAGAAGGG + Intergenic
1071094166 10:81953490-81953512 TTCACAAGAATGTATCAGAATGG - Intronic
1072194664 10:93106943-93106965 TACACAAGACTGCAGAAAAGTGG - Intergenic
1072951464 10:99850267-99850289 TAAACAAGTTTGGATAACAATGG - Intronic
1074860528 10:117506675-117506697 TACACAGGATTGTAGAAGGAAGG - Intergenic
1074988748 10:118682808-118682830 TAGATGAGATTGCAGAAGAATGG - Exonic
1079658456 11:23011492-23011514 TACACAAAATTCCACAAGTAGGG - Intergenic
1080441711 11:32300351-32300373 AAAACAAGATTGAAGAAGAAAGG - Intergenic
1080766474 11:35301940-35301962 TACACATGATTTCATAAGTGAGG - Intronic
1081615637 11:44589434-44589456 TACACAAGAAAGCATAACATTGG + Intronic
1081845220 11:46236644-46236666 TACAAAAGTATGCATAGGAATGG + Intergenic
1086387075 11:86320263-86320285 TTTACAAGATTTCTTAAGAAAGG - Intronic
1090581748 11:128167994-128168016 AACACAACATTTGATAAGAAAGG + Intergenic
1090996445 11:131870123-131870145 TTCACAAGAGTGCATGAAAATGG - Intronic
1093290599 12:17316403-17316425 TACACAGAATTGCATAAGCATGG + Intergenic
1093539012 12:20258312-20258334 TATCCAAGACTGCTTAAGAAAGG - Intergenic
1093613705 12:21194757-21194779 TACACAAGAATGCATGAGACTGG + Intronic
1094030283 12:26004212-26004234 TACACAGAATTGAATAACAAGGG + Intronic
1095272039 12:40230495-40230517 TAAGCCAGATTGTATAAGAACGG - Intronic
1096958943 12:55558057-55558079 TTCAAAAGATTGCATACTAATGG - Intergenic
1098032565 12:66269447-66269469 TACAAGAGATTGTATAAAAATGG - Intergenic
1098152324 12:67559634-67559656 TATACAAGATTGAGAAAGAAAGG + Intergenic
1099925555 12:89012142-89012164 TAGAGAAGGTTCCATAAGAATGG + Intergenic
1101664879 12:106803325-106803347 TACAAAAGATTCTATAAAAATGG - Intronic
1105024925 12:132841656-132841678 TACACAACAGAGCATCAGAAAGG + Intronic
1106632485 13:31490743-31490765 GCCTCAAGATTGCATAATAAGGG - Intergenic
1107795823 13:44050645-44050667 TCCACCAGATGGCAGAAGAAGGG + Intergenic
1107905665 13:45058757-45058779 TACACAAGATTTTGTAAGCATGG - Intergenic
1108105511 13:47004408-47004430 TACACAACTTTGCATACGTAAGG - Intergenic
1108125464 13:47238167-47238189 TACACAAGTTTTCTTAAGCAAGG - Intergenic
1109569343 13:64165669-64165691 TCCACATGGTTGCATAAGCATGG - Intergenic
1110058797 13:71014984-71015006 TACCCTATATTGCATAAAAAGGG - Intergenic
1111129015 13:83950113-83950135 AAAACAAGTTTGCAAAAGAATGG + Intergenic
1111748778 13:92300725-92300747 TACACAATATTGCTTAAGATAGG - Intronic
1111946009 13:94666618-94666640 TACACATTATTGCAGAGGAAGGG - Intergenic
1112217980 13:97455614-97455636 TACACAAGACAGCATAGTAAAGG - Intronic
1113390958 13:109896315-109896337 TACAAAAGAATGCATACAAATGG - Intergenic
1113399203 13:109975783-109975805 TACACAAGGATGGATAAGAGGGG + Intergenic
1114239183 14:20850265-20850287 TAAACAAGATTGCTAAAAAAAGG - Intergenic
1115031134 14:28795325-28795347 TACACAACATTGGGTAAGGAGGG + Intronic
1116044762 14:39731400-39731422 TACTTAAGATGGCATCAGAAAGG - Intergenic
1202936262 14_KI270725v1_random:90480-90502 TACTCAAGAATGCATAAAAGGGG - Intergenic
1124825193 15:33087235-33087257 AAAACAAGAATGAATAAGAAAGG + Intronic
1125121433 15:36163255-36163277 TACACATGACTGCATAATTATGG + Intergenic
1127143789 15:56003915-56003937 TACATGGGATTGCATCAGAAGGG - Intergenic
1127306784 15:57713944-57713966 TTCACAAGAATGAACAAGAATGG - Intronic
1127750174 15:62030243-62030265 AACAAAAGGTTGTATAAGAAAGG + Intronic
1128534364 15:68479537-68479559 CAGACAGGGTTGCATAAGAAGGG + Intergenic
1128586449 15:68855287-68855309 TAAAAAAGATTGCATAGGATTGG + Intronic
1131124539 15:89847686-89847708 TAAACAAGAAGGCATAAGCAAGG + Intronic
1134264232 16:12679566-12679588 TACACAAAATTTCACAAAAATGG + Intronic
1135286798 16:21200511-21200533 TACACACTATTCCATAAGAATGG + Intronic
1135347915 16:21705096-21705118 TACACAAAATTGAACCAGAATGG + Intronic
1135901174 16:26461216-26461238 CACACAAGAAAGCATAAGAAGGG - Intergenic
1137297613 16:47111541-47111563 TACTCCAGATTGCATGAGAAGGG + Intronic
1137698607 16:50479160-50479182 TATATACGATTACATAAGAAGGG - Intergenic
1138354169 16:56364501-56364523 TGCAGAAGATTGGATAAGACTGG - Intronic
1138899126 16:61246998-61247020 TACACAAGATATTATGAGAATGG - Intergenic
1140021319 16:71241651-71241673 AACACAAGAGTGGTTAAGAAAGG + Intergenic
1140702144 16:77591066-77591088 TAGCCAAGATTGCAAAATAATGG + Intergenic
1141435592 16:83998057-83998079 TACCCATGAATGGATAAGAATGG - Intronic
1143790333 17:9289840-9289862 CACAAAATATTGCATGAGAAAGG + Intronic
1147011718 17:37454639-37454661 TACAGAAGAAAGCATAAAAAAGG + Intronic
1149725261 17:58886786-58886808 TGCAAAAGATTACATATGAAAGG + Intronic
1154103632 18:11500238-11500260 TGCAAAAGTTTGCATAAAAAGGG - Intergenic
1154320102 18:13342987-13343009 TACACAAAAGTACATGAGAAGGG - Intronic
1154487815 18:14890905-14890927 AAAACATGTTTGCATAAGAATGG + Intergenic
1155610198 18:27658630-27658652 TTCACAAGATTGCGTGAGAATGG + Intergenic
1156602118 18:38619952-38619974 TACTGAAGACAGCATAAGAAAGG + Intergenic
1156696563 18:39774723-39774745 ATCACCAGATTTCATAAGAATGG + Intergenic
1156884107 18:42114072-42114094 TACCCATGATTGCATCAGAACGG + Intergenic
1157434092 18:47653948-47653970 TACACAGGAATGCCCAAGAAGGG + Intergenic
1158106255 18:53888272-53888294 TTCACAGAATTGCATAAGACTGG - Intergenic
1162225400 19:9217139-9217161 TACACAAGATGAGAAAAGAAAGG + Intergenic
1167753762 19:51397408-51397430 AAGACAAGAGTGCATAAGATGGG + Intergenic
1202684283 1_KI270712v1_random:35025-35047 TACTCAAGAATGCATAAAAGAGG + Intergenic
928388868 2:30893416-30893438 AACAAAAGATTGTACAAGAAAGG + Intergenic
928662836 2:33520929-33520951 GACACAAGATAGCACATGAAAGG + Intronic
930560157 2:52950375-52950397 TACAGAAATTTGCATAAGTAAGG - Intergenic
932061277 2:68501050-68501072 TACACAAGATTGCATAAGAATGG - Intronic
934247435 2:90319822-90319844 TACTCAAGAATGCATAAAAGAGG - Intergenic
934261890 2:91482781-91482803 TACTCAAGAATGCATAAAAGAGG + Intergenic
934466704 2:94269519-94269541 TACTCAAGAATGCATAAAAGGGG - Intergenic
935039511 2:99412344-99412366 TCCAAAAGCTTGCATAAGGAGGG + Intronic
939574192 2:143876394-143876416 TCCATAAAATTGCCTAAGAAAGG - Intergenic
939724389 2:145698166-145698188 TTCACAAGGTTAAATAAGAATGG + Intergenic
940633998 2:156275127-156275149 AAAAGAAGCTTGCATAAGAAAGG + Intergenic
942627190 2:177914041-177914063 TAGACAAGATTTTAAAAGAATGG - Intronic
942904801 2:181167251-181167273 TACAGAAATTTGCATAAGTAAGG - Intergenic
943134630 2:183893968-183893990 TTCACAAGATGGCAGGAGAAAGG - Intergenic
946528391 2:220544472-220544494 TACATAGGATTAAATAAGAAAGG - Intergenic
948022068 2:234742164-234742186 AACAAAAAGTTGCATAAGAAAGG + Intergenic
948290936 2:236823909-236823931 TACAACAGATTGAATAGGAAAGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169087216 20:2835009-2835031 TACACATGAATGCATGAGACCGG + Intergenic
1169883202 20:10369596-10369618 TACACAATTTTAAATAAGAATGG + Intergenic
1172259848 20:33553767-33553789 TTTGCAAGATTGCATAACAAGGG - Intronic
1173198281 20:40934058-40934080 TACACAAGAATGCAAAAGTGGGG + Intergenic
1173680899 20:44880956-44880978 ACCACCAGATTGCCTAAGAAGGG - Intergenic
1174897329 20:54463920-54463942 TAGTCAAGATAGCATAAAAATGG + Intergenic
1176587238 21:8599125-8599147 TACTCAAGAATGCATAAAAGGGG + Intergenic
1177560807 21:22750482-22750504 AACACAACATTGAATAAGTAAGG - Intergenic
1180270069 22:10576122-10576144 TACTCAAGAATGCATAAAAGGGG + Intergenic
1180280614 22:10690156-10690178 TACTCAAGAATGCATAAAAGGGG - Intergenic
1180587836 22:16908694-16908716 TACGCAAGAATGCATAAAAGGGG - Intergenic
1183248980 22:36714906-36714928 TACACGAGAATGCTCAAGAAAGG + Intergenic
1183798073 22:40137488-40137510 TACAGAAGAATCCCTAAGAAGGG + Intronic
952071950 3:29647884-29647906 TATAAAGAATTGCATAAGAATGG + Intronic
952810824 3:37401102-37401124 TGCACAGGATTACATATGAATGG - Intronic
953549635 3:43891568-43891590 TACTGAAGATTTCATAAGAGAGG + Intergenic
955001195 3:54929296-54929318 TTCACAATTTTGCATGAGAAAGG + Intronic
955821164 3:62897049-62897071 GACACAATATTTTATAAGAATGG - Intergenic
956801436 3:72763000-72763022 AAAACAAGATGGCATAATAAAGG - Intronic
956839742 3:73127174-73127196 TTCACAAAAGTGCAGAAGAATGG - Intergenic
958786665 3:98603941-98603963 TATGAATGATTGCATAAGAAAGG + Intergenic
959572132 3:107895973-107895995 TTAAGAAGTTTGCATAAGAAGGG + Intergenic
968120096 3:196120040-196120062 GACACAAAATTCAATAAGAACGG - Intergenic
969856778 4:10006402-10006424 CACACACCATTGCATAAGAGAGG + Intronic
969904379 4:10380430-10380452 TACACAATAGAGCAGAAGAAGGG - Intergenic
970486566 4:16530635-16530657 TGCAAAAGATTCCAGAAGAAGGG - Intronic
971112502 4:23604350-23604372 TAGGCAAGATTAAATAAGAAAGG - Intergenic
972846068 4:42991362-42991384 AGCACAAAATGGCATAAGAATGG - Intronic
974436344 4:61862080-61862102 CAGACAAGATTGTAGAAGAAAGG + Intronic
974584328 4:63852783-63852805 TATACAAGATAGCTTCAGAAAGG - Intergenic
975770663 4:77718636-77718658 TACATGGGATTGCATCAGAAGGG - Exonic
977016031 4:91693996-91694018 TGCATAAATTTGCATAAGAAAGG - Intergenic
977024160 4:91794420-91794442 TACAAAGAATTGCAAAAGAATGG + Intergenic
979337143 4:119476314-119476336 CACACAGGATTCCATAACAATGG + Intergenic
981112174 4:140948074-140948096 TACACTAGATTCCAGAAGAATGG - Intronic
981880309 4:149602822-149602844 AAAACAAGAGTGCATAAAAAAGG - Intergenic
982970544 4:161979371-161979393 TACATAAGAGTGTATAAGACTGG + Intronic
983865953 4:172767093-172767115 TAAAGAATATTGCATGAGAATGG + Intronic
984593748 4:181644504-181644526 AAGACAAGATTGCAGAAGCATGG - Intergenic
986120746 5:4833881-4833903 TAAACAAGATGGAATAACAACGG - Intergenic
986850240 5:11803341-11803363 TGCACAAGAGTGCACAAGAGGGG + Intronic
989558027 5:42819643-42819665 TACTAAAGATTTCACAAGAAAGG - Intronic
992846284 5:80751992-80752014 AACACAAAATTGCACAAGATTGG - Intronic
992963021 5:81974101-81974123 TACAGAAGATTTCTTAAGATGGG + Intronic
993683495 5:90909063-90909085 GAGAAAAGATGGCATAAGAAGGG - Intronic
994241385 5:97425409-97425431 AACACAAAATAGCTTAAGAATGG - Intergenic
994336673 5:98575505-98575527 TACATAAGCCTGCATATGAAGGG + Intergenic
995907146 5:117138921-117138943 TACATAAGATTGTATCAGATAGG + Intergenic
998285887 5:140860567-140860589 TACACAAGAAGGTATAGGAAAGG + Intronic
998565027 5:143209375-143209397 CACACAAGATGGCAACAGAATGG - Intronic
998680376 5:144460194-144460216 AACACAAGATGGCATACGCAAGG - Intronic
998858071 5:146414016-146414038 CACACAAGCTTGCCTAAGTATGG + Intergenic
1008450484 6:51645011-51645033 TCCTCAAATTTGCATAAGAATGG + Intronic
1008770341 6:54971119-54971141 TTTTCAAGATTGCATAAGAAGGG - Intergenic
1010087844 6:71941551-71941573 CTCAGAAGATGGCATAAGAAGGG - Intronic
1010116189 6:72315637-72315659 GACAGAAGAATGCATATGAAGGG - Intronic
1018272587 6:162096301-162096323 TACACAAAATTGGATGTGAATGG - Intronic
1018464513 6:164031492-164031514 TACACAAGATTCGGTAAGCAAGG - Intergenic
1019882526 7:3875499-3875521 GACACACGATTGCATAGGAGAGG - Intronic
1021689036 7:23214433-23214455 TACAGAAAATGGCAAAAGAAGGG - Intergenic
1023151606 7:37206572-37206594 TACACAAAATTACATATGCAGGG - Intronic
1024390628 7:48807696-48807718 TACACATGGCTACATAAGAAAGG - Intergenic
1027789229 7:82618281-82618303 TACATAAGAATGAATAAGAATGG - Intergenic
1028470626 7:91202890-91202912 TAAACAGAATTGCATAATAAAGG - Intronic
1030693111 7:112555248-112555270 TCCACAACATTTCATAGGAATGG - Intergenic
1031347577 7:120687920-120687942 TACTCTTGATTGCATAATAAGGG + Intronic
1033105978 7:138523775-138523797 CAGACAAGTTTGTATAAGAAAGG - Intronic
1034133144 7:148739520-148739542 TACAAAAGATGACATACGAATGG - Intronic
1037125802 8:15347053-15347075 TTGAAAAGTTTGCATAAGAAAGG + Intergenic
1037521195 8:19681967-19681989 TTCACCAGTTTGCATAAGAGAGG + Intronic
1038604031 8:28980173-28980195 TACACATGATTCCAGAATAAAGG - Intronic
1039440187 8:37589713-37589735 TTTACAAGGTTGCAAAAGAATGG + Intergenic
1041722755 8:60991036-60991058 TACTCAATTTTGCATAAGATAGG - Intergenic
1041960308 8:63607426-63607448 CACCCAAGAGTGCATTAGAAAGG + Intergenic
1046406322 8:113777296-113777318 TACAAATGATTGCCTAAGATAGG + Intergenic
1046597773 8:116281483-116281505 GACACAAGGTTGCACAAGGATGG + Intergenic
1047978046 8:130151070-130151092 AACAAAAGATTGCTGAAGAAGGG + Intronic
1048358994 8:133679216-133679238 TTCACCAGATTGTATAAGCAAGG - Intergenic
1048527870 8:135220467-135220489 TAGAAAAGCTTGCATAAGATAGG + Intergenic
1048542627 8:135356180-135356202 GAAACATGATTGGATAAGAAGGG - Intergenic
1051227176 9:14911504-14911526 AAGAAAAGAATGCATAAGAAGGG + Intergenic
1051747945 9:20312966-20312988 TACAGAAAATGGCATTAGAAAGG + Intergenic
1052241086 9:26274561-26274583 TACCCAAGGTTGGATAAGGATGG - Intergenic
1053283786 9:36837956-36837978 TACACATCATTCCAAAAGAAGGG + Exonic
1053526571 9:38835976-38835998 TAGTCAAGATGGCATCAGAAAGG - Intergenic
1054198799 9:62060411-62060433 TAGTCAAGATGGCATCAGAAAGG - Intergenic
1054440365 9:65255003-65255025 TACTCAAGAATGCATAAAAGGGG - Intergenic
1054490042 9:65766935-65766957 TACTCAAGAATGCATAAAAGGGG + Intergenic
1054639556 9:67527956-67527978 TAGTCAAGATGGCATCAGAAAGG + Intergenic
1055712459 9:79078156-79078178 TACAGAAAATTTCATAAGAAAGG + Intergenic
1058839212 9:108889925-108889947 TACACAAGAGAGCAAAAGAAAGG - Intronic
1059183450 9:112242670-112242692 TCCACAAGGTTGCCTAAGGAAGG - Intronic
1059233595 9:112743442-112743464 CACACATGATTGCATTTGAAAGG + Intergenic
1059746974 9:117211931-117211953 TTCTCAAGATTGCATGAGCATGG - Intronic
1203586272 Un_KI270747v1:6361-6383 TACTCAAGAATGCATAAAAGGGG - Intergenic
1203617197 Un_KI270749v1:76836-76858 TACTCAAGAATGCATAAAAGGGG + Intergenic
1187916685 X:24159361-24159383 CAAACAAGATTACATAAAAAAGG - Intronic
1193184299 X:78494128-78494150 TACAGAAGATTGCAAGGGAAAGG - Intergenic
1193778850 X:85678185-85678207 ATCATAAGATTGCATAATAAAGG + Intergenic
1195294360 X:103461016-103461038 TACTCAAGATTGCACATGACAGG - Intergenic
1195498892 X:105570758-105570780 TATACATGTTTGCATCAGAAAGG + Intronic
1196849097 X:119920584-119920606 CAGACACGATTGAATAAGAAGGG - Exonic
1196988742 X:121304072-121304094 TACACTAGAGTGCATTATAAAGG - Intergenic
1197989998 X:132307807-132307829 AACACTATATTGAATAAGAATGG + Intergenic
1198040858 X:132850905-132850927 TACACAGGATTGTTAAAGAAAGG - Intronic
1198891912 X:141406076-141406098 TACACAATATTGCATACCACTGG - Intergenic
1199095179 X:143729869-143729891 TACACAAGACCTCATATGAATGG - Intergenic
1201194484 Y:11478261-11478283 TACTCAAGAATGCATAAAAGGGG - Intergenic
1201249009 Y:12036973-12036995 CTCACAAGATTGCAGAGGAAAGG + Intergenic
1202074205 Y:21022049-21022071 CACTCAAGATTGCAACAGAATGG - Intergenic