ID: 932061461

View in Genome Browser
Species Human (GRCh38)
Location 2:68503983-68504005
Sequence CAGTATCAACAGTAGAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932061461 Original CRISPR CAGTATCAACAGTAGAAGAG GGG Intronic
901409885 1:9075408-9075430 CGGTATCAGCAGAAGAGGAGCGG - Intronic
907985988 1:59530977-59530999 CAGTATCAATGGAACAAGAGGGG + Intronic
909053090 1:70791015-70791037 GAGTATCAGCATTGGAAGAGTGG - Intergenic
909751203 1:79164011-79164033 CAGTATCAAAGGCAGAATAGAGG - Intergenic
910015856 1:82522298-82522320 CAGTATTAACAGTAGCAGTATGG + Intergenic
910505298 1:87943739-87943761 CATTCTCAAAAGTAGAAGATTGG - Intergenic
913227643 1:116713949-116713971 CAGTATCAAAGGTGGAGGAGTGG + Intergenic
913499857 1:119462145-119462167 CAGGATCAAAGGTGGAAGAGTGG + Intergenic
913507758 1:119533866-119533888 CAGGATCAAAGGTGGAAGAGTGG + Intergenic
913510677 1:119558870-119558892 CAGGATCCAAGGTAGAAGAGTGG + Intergenic
915607947 1:156965822-156965844 CAGTGTGATCTGTAGAAGAGAGG - Intronic
916724520 1:167510736-167510758 TAGTATCTACAGCAAAAGAGGGG + Intronic
916962620 1:169904560-169904582 CAGTATCACCAGGAGAACACAGG - Intergenic
916993701 1:170273056-170273078 CAGTGTCAGTAGTAGAAGTGGGG + Intergenic
917237983 1:172915390-172915412 CAGTATCAAAGGAAGAAAAGGGG - Intergenic
917609587 1:176673369-176673391 CAAAAGCAACAGTAGCAGAGGGG + Intronic
918153912 1:181825567-181825589 TAATGTCAACATTAGAAGAGGGG + Intergenic
918765773 1:188481557-188481579 AAATATCAAAAGGAGAAGAGAGG - Intergenic
918970984 1:191418788-191418810 CAGTTTCAAAAGTAGAAGGCAGG - Intergenic
919001759 1:191841450-191841472 GAGTATGAACAGTTCAAGAGAGG + Intergenic
919244318 1:194959546-194959568 GAGTAGAAACAGCAGAAGAGAGG - Intergenic
924245560 1:242080310-242080332 CAATCTCATCAGTAGAAGTGTGG - Intergenic
1066805171 10:39241866-39241888 CAGGATCAAAACTAGAAGATAGG + Intergenic
1068069518 10:52179379-52179401 AAGTACCAAAAGTAGAAGAGGGG - Intronic
1069814138 10:71182862-71182884 CAGTTTCAACAGATGAACAGGGG + Intergenic
1070314831 10:75300084-75300106 CAGTCTCAACCATAGAAGACTGG + Intergenic
1072035096 10:91555923-91555945 AAATGTCAACAGTACAAGAGTGG - Intergenic
1073056242 10:100704562-100704584 CTATAGCAACAGTAGAAGACTGG + Intergenic
1075241579 10:120784165-120784187 CTGTATCAACAGAAGTATAGTGG + Intergenic
1075435977 10:122442171-122442193 CAGTATCAGCAGTGGAAGCCAGG - Exonic
1077986839 11:7360702-7360724 CAACATGAACAGTAGGAGAGAGG - Intronic
1081340330 11:41919834-41919856 CTGTACCAAAAGGAGAAGAGAGG - Intergenic
1083741644 11:64714373-64714395 CAGTATCAAGAGCTGATGAGAGG - Intronic
1084995364 11:72972157-72972179 GAGAATCAACAATAGATGAGGGG - Intronic
1086093081 11:83023500-83023522 CAGTAGCACGAGTAGAAGAGAGG - Intronic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1087139348 11:94750322-94750344 CAGTGTCAAGTGGAGAAGAGAGG - Intronic
1087272555 11:96126255-96126277 CAGTAAAAACAATAGCAGAGAGG + Intronic
1087852310 11:103046376-103046398 CAGAATAAACTGTAGAACAGGGG + Intergenic
1089001994 11:115059867-115059889 CAGTACAAACAGTAGTGGAGGGG + Intergenic
1091296806 11:134479677-134479699 CAGATTCAACAGCAGAAGAGTGG + Intergenic
1092026415 12:5244634-5244656 CAGTGTAAACAGCAGAAGAAAGG - Intergenic
1092243567 12:6850497-6850519 CAATACCAAGAGTAGGAGAGCGG + Exonic
1095318212 12:40792638-40792660 CAAGATAAAAAGTAGAAGAGAGG - Intronic
1097560545 12:61199475-61199497 CAATATAAACACTAGAAAAGGGG - Intergenic
1097604531 12:61736168-61736190 AATTATCAACATTAGAGGAGTGG - Intronic
1097693525 12:62756095-62756117 CAGCATCAAAGGTTGAAGAGTGG - Intronic
1098892748 12:76026305-76026327 CAGTAGCAGCCTTAGAAGAGTGG - Exonic
1100416664 12:94385112-94385134 GGGTATCAACAGAAGTAGAGTGG - Intronic
1102387625 12:112523353-112523375 CATTATTAACAGTAGAAAAATGG - Intergenic
1102965099 12:117119700-117119722 CAGTAGCAACAGTAAGATAGTGG - Intergenic
1106237695 13:27878340-27878362 CAGTTCTCACAGTAGAAGAGGGG + Intergenic
1109252670 13:60039202-60039224 CAGTTTCAGAAGTTGAAGAGTGG + Intronic
1110352347 13:74523369-74523391 CAGTAACAACAGCAGGAAAGGGG - Intergenic
1111057520 13:82971057-82971079 CAGAATGAGCAGTAGAAAAGGGG - Intergenic
1112886661 13:104181990-104182012 CAGTATTAACATTAAAACAGAGG - Intergenic
1113828739 13:113277548-113277570 CAGTATCAACAATAGTGAAGGGG + Intergenic
1114348953 14:21828820-21828842 TATAATCAACAGAAGAAGAGTGG - Intergenic
1114356705 14:21917523-21917545 CAGTACCAACAGTCGAAATGTGG - Intergenic
1118759491 14:68871205-68871227 CAGTATCAAAAGTTGCATAGTGG - Intergenic
1118940583 14:70332608-70332630 CGGGATCTACTGTAGAAGAGAGG - Intronic
1123888850 15:24755289-24755311 CAGTGTTAAGAGTGGAAGAGAGG - Intergenic
1126723122 15:51603244-51603266 CAATATCAAGAATAAAAGAGGGG + Intronic
1127352184 15:58164139-58164161 CAGCATCTAGAGTGGAAGAGGGG + Intronic
1128036193 15:64528783-64528805 CAGCATCGAAGGTAGAAGAGTGG + Intronic
1131409195 15:92192091-92192113 TAGTATCAGAAGTAGATGAGTGG + Intergenic
1137663534 16:50232313-50232335 CAGAATCAACTGTTGAAGACTGG - Intronic
1138965584 16:62080334-62080356 CAGAATCATCAGTAGAAGAATGG - Intergenic
1140079616 16:71732857-71732879 CAGCCTCAACAGTGGAGGAGAGG + Exonic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142923278 17:3209855-3209877 TACTATCAACAATAGAATAGTGG - Intergenic
1144298626 17:13902600-13902622 CAGTTTCACCAGTGGAAGAGGGG - Intergenic
1150495926 17:65607710-65607732 CAGTATCAACAGCAGAGGCAGGG + Intronic
1154097054 18:11428004-11428026 CAATATCAGGAGTAAAAGAGTGG - Intergenic
1155064545 18:22257169-22257191 GAGTAACAGCAGCAGAAGAGTGG - Intergenic
1155439508 18:25847205-25847227 CAGTATCATCTGTGGCAGAGTGG - Intergenic
1157306407 18:46520685-46520707 CACCATCAACAGCAGTAGAGTGG - Intronic
1157357222 18:46946962-46946984 CCGCAGCAACAGTAGGAGAGGGG - Intronic
1158651558 18:59292588-59292610 CAATATCAACATTGAAAGAGGGG - Intronic
1166012282 19:39951336-39951358 AAGGATCCACAGTAGCAGAGAGG + Intergenic
1166230752 19:41424827-41424849 CTGTAACAACAGGTGAAGAGGGG - Exonic
1166254751 19:41595532-41595554 CAGTGTCAACAGCAAAGGAGAGG + Intronic
1166538991 19:43593387-43593409 CAGGGTCAAAGGTAGAAGAGGGG + Intronic
926764572 2:16313025-16313047 CAGCCTCAGCAGTAGAACAGGGG - Intergenic
926795963 2:16618966-16618988 CAGCATGAACAGTGAAAGAGGGG + Intronic
927066368 2:19475264-19475286 CAGTATTTCCAGTAGTAGAGGGG - Intergenic
927525396 2:23735398-23735420 CCATATCATCAGTAGATGAGTGG + Intergenic
927820739 2:26261942-26261964 CAGTATCAACATGAGTAAAGAGG - Intronic
928114042 2:28533129-28533151 GAGTATCTACTGTAGGAGAGGGG - Intronic
931578818 2:63751302-63751324 CAGTATCAGAAATAAAAGAGAGG - Intronic
932050459 2:68393132-68393154 CAGGATCAACATTAAAAGAAGGG - Intronic
932061461 2:68503983-68504005 CAGTATCAACAGTAGAAGAGGGG + Intronic
932212573 2:69944805-69944827 GAGGATCAGCAGTAGAGGAGGGG - Intergenic
933314113 2:80695618-80695640 CAGTAACGACATCAGAAGAGTGG - Intergenic
933811270 2:86034228-86034250 CAGAATCTACTGTAGGAGAGGGG + Intronic
933871356 2:86568436-86568458 CAGTATCAGAATTAGAAGAGTGG + Intronic
936625832 2:114148569-114148591 CATTATCAACAGTCTACGAGAGG - Intergenic
937810457 2:126194247-126194269 CAGTATAAACAATAGGAGATGGG + Intergenic
940905867 2:159169068-159169090 CAGTATCATTAGTTGAAAAGTGG - Intronic
943066492 2:183091954-183091976 GACTATCCACAGTAGTAGAGGGG - Intronic
945545913 2:211151436-211151458 AATTATCAACACTAGAAGATTGG - Intergenic
947146636 2:227073073-227073095 CAGCATCAAAATTAGAAAAGAGG + Intronic
1173067268 20:39725206-39725228 CAGTTGCAACAGCAGAAAAGGGG + Intergenic
1177215514 21:18123308-18123330 CCGTATCTACAGGAGCAGAGTGG - Intronic
1182489135 22:30658484-30658506 CAATCTGAAAAGTAGAAGAGGGG + Intronic
1185305492 22:50113112-50113134 CTGTAGCATCAGTAGAAGAAGGG + Intronic
949316507 3:2762149-2762171 CAGAATAAGCAGTAGAAAAGCGG + Intronic
952226404 3:31381201-31381223 CAGTATAGAAAGTAGAACAGGGG - Intergenic
952747056 3:36791368-36791390 CAGAATCAGCAGAAGAGGAGTGG - Intergenic
953854425 3:46489764-46489786 CAGCTTCAACAGTAAGAGAGCGG + Intergenic
958735982 3:98010210-98010232 GAAAATCAACAGTAGAAAAGAGG + Intronic
958953404 3:100440633-100440655 CAGTATAAAGAATAGAAGAAAGG - Intronic
960205716 3:114895138-114895160 CAAACTCAACAGTAGAAAAGTGG - Intronic
960748439 3:120917333-120917355 CAGTACCAAGAGTAGAAGTAGGG + Intronic
963545037 3:146646080-146646102 CAGTATCATAAGTAGATCAGAGG - Intergenic
963619630 3:147589731-147589753 CAGTATCTACAGTAGAAAAGTGG - Intergenic
965973844 3:174596295-174596317 CAGCATCAATGGTAGTAGAGAGG - Intronic
967351963 3:188523977-188523999 CAGAATCAACAGGAGAGTAGAGG - Intronic
972610369 4:40650612-40650634 CTGTCTCAAAAGAAGAAGAGAGG - Intergenic
975109575 4:70608594-70608616 CAGCAGCAACAGTGGAAGAATGG + Intergenic
976732227 4:88274642-88274664 CAGTATCAGTATTATAAGAGTGG - Intronic
980325861 4:131344957-131344979 CAGTGTCAGGAGTAGAGGAGAGG + Intergenic
983654656 4:170070887-170070909 CAGAATAAACATTAGATGAGTGG + Intronic
987191377 5:15481854-15481876 CAGTCTCAACATTAAAAGGGAGG - Intergenic
988244849 5:28666807-28666829 CAGCATTAACAGTAAAATAGAGG - Intergenic
988544722 5:32144731-32144753 CAGCATCCACAGTGGAAGAACGG + Intronic
988840799 5:35081870-35081892 CAGCCCCAAAAGTAGAAGAGGGG - Intronic
992812491 5:80403145-80403167 CTATATCAACAGTAAAAAAGAGG - Intergenic
993882043 5:93374439-93374461 CAATGTCAACATTGGAAGAGAGG - Intergenic
996809563 5:127500969-127500991 CAGAAAGAACAGTAGACGAGTGG - Intergenic
999420954 5:151442666-151442688 CTGTACAAACAGTAGAACAGAGG - Intronic
999839850 5:155413245-155413267 CAGAATGAACAGGAGAGGAGTGG + Intergenic
1001109303 5:168882583-168882605 CAGTATCAACACTAGGAAACTGG - Intronic
1002584322 5:180232393-180232415 CAGTAACAACAGTGACAGAGTGG - Intergenic
1007994809 6:46295523-46295545 CTGTATCAAAAGTTGAAGAGGGG + Intronic
1008866911 6:56223199-56223221 CAGTAACATCAGTAGATGAGAGG + Intronic
1010484198 6:76390372-76390394 CAGTAACAACAGAATAAGAATGG - Intergenic
1010860796 6:80907890-80907912 CTTTCTCAAAAGTAGAAGAGAGG - Intergenic
1014034677 6:116752533-116752555 CATCAGCAACAGTAGAAGATGGG - Exonic
1014499714 6:122171033-122171055 CAGTATCAGGAATGGAAGAGGGG + Intergenic
1016301841 6:142640751-142640773 CAATATCAAAAGTAGACAAGAGG + Intergenic
1016381520 6:143487663-143487685 CAGCATGAACAGTAGCAGACAGG - Intronic
1017171004 6:151454492-151454514 CAGCATCAATACTAGAAGACTGG - Intronic
1020068702 7:5211105-5211127 CAGAATCAACACGAGAAGATAGG + Intronic
1021860289 7:24899282-24899304 CAGTATTAACAGTTGCAGTGTGG - Intronic
1024184272 7:46933112-46933134 CTGAATCCAGAGTAGAAGAGAGG + Intergenic
1024296016 7:47842898-47842920 CAGTGTCAACATCAGAAGTGAGG - Intronic
1026329361 7:69338380-69338402 CAGTAACAACTGTTTAAGAGAGG + Intergenic
1028635730 7:92987104-92987126 CAGTATCAACAAAAGAAAAAGGG + Intergenic
1034229312 7:149508837-149508859 CAGGATCTACAGTGGAACAGAGG - Intergenic
1036156722 8:6348901-6348923 TAGTTTCAACAGTAGGAGAAAGG + Intergenic
1040504546 8:48035427-48035449 CTGTTTTATCAGTAGAAGAGGGG - Intronic
1041709680 8:60882468-60882490 CAGTAACACCAGTAGAAAAATGG - Intergenic
1043364770 8:79520224-79520246 CAGCAGCAACAGTACAAGTGAGG + Intergenic
1045796707 8:106054381-106054403 CAGTAGAAAAAGCAGAAGAGAGG + Intergenic
1050869350 9:10547133-10547155 CAATATCAACAGAAGAATTGGGG + Intronic
1051671476 9:19515110-19515132 CATTATCATCAAAAGAAGAGGGG - Exonic
1052475966 9:28959237-28959259 CGGTCTCAACATTAGAAGATGGG + Intergenic
1055336841 9:75240273-75240295 CAGTTGCAGCAGTGGAAGAGTGG + Intergenic
1059411644 9:114136292-114136314 CAGGACCAACAGTACAGGAGGGG + Intergenic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1187195761 X:17082084-17082106 CTGAATCAAGAGTAGAAGAGAGG - Intronic
1188001048 X:24982187-24982209 CAGCATCAAAAGTAGAATGGTGG - Intronic
1188063590 X:25630499-25630521 CAGAAGGAACAGCAGAAGAGAGG - Intergenic
1188452445 X:30322125-30322147 CAGTTTTAATAGTGGAAGAGTGG - Intergenic
1188845415 X:35065929-35065951 CAGTATAGACAGTTGCAGAGTGG + Intergenic
1191891583 X:65948541-65948563 CAGTATCAGAAGAAGAAAAGGGG - Intergenic
1194366434 X:93019408-93019430 CAGTGGCAGCAGTGGAAGAGGGG - Intergenic
1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG + Intergenic
1194564961 X:95474127-95474149 CAGTGTCAACTGCAGGAGAGAGG - Intergenic
1196990637 X:121325212-121325234 CACTAGCAACAGTTGCAGAGAGG - Intergenic
1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG + Intergenic
1199890328 X:152072615-152072637 CAGTTTGAACAAGAGAAGAGAGG + Intergenic
1199976205 X:152896292-152896314 CAGTAGCCACAGTGGAGGAGGGG + Intergenic
1200674661 Y:6135670-6135692 CAGTGGCAGCAGTGGAAGAGGGG - Intergenic