ID: 932064321

View in Genome Browser
Species Human (GRCh38)
Location 2:68537126-68537148
Sequence CTGTCTCCCAACCTGGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12009
Summary {0: 2, 1: 9, 2: 421, 3: 4712, 4: 6865}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932064321_932064324 21 Left 932064321 2:68537126-68537148 CCACACTCCAGGTTGGGAGACAG 0: 2
1: 9
2: 421
3: 4712
4: 6865
Right 932064324 2:68537170-68537192 AAAAAAAAAGAGAAATTATAAGG 0: 1
1: 5
2: 132
3: 1837
4: 19762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932064321 Original CRISPR CTGTCTCCCAACCTGGAGTG TGG (reversed) Intronic
Too many off-targets to display for this crispr