ID: 932066112

View in Genome Browser
Species Human (GRCh38)
Location 2:68562778-68562800
Sequence GAGATTATGAAGGACCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 1, 2: 6, 3: 29, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932066107_932066112 22 Left 932066107 2:68562733-68562755 CCCCTAGAGTAGAAACAAAAGAT 0: 1
1: 0
2: 2
3: 21
4: 260
Right 932066112 2:68562778-68562800 GAGATTATGAAGGACCTTGAAGG 0: 1
1: 1
2: 6
3: 29
4: 254
932066109_932066112 20 Left 932066109 2:68562735-68562757 CCTAGAGTAGAAACAAAAGATTG 0: 1
1: 0
2: 4
3: 27
4: 283
Right 932066112 2:68562778-68562800 GAGATTATGAAGGACCTTGAAGG 0: 1
1: 1
2: 6
3: 29
4: 254
932066108_932066112 21 Left 932066108 2:68562734-68562756 CCCTAGAGTAGAAACAAAAGATT 0: 1
1: 0
2: 2
3: 24
4: 328
Right 932066112 2:68562778-68562800 GAGATTATGAAGGACCTTGAAGG 0: 1
1: 1
2: 6
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932066112 Original CRISPR GAGATTATGAAGGACCTTGA AGG Intronic
902475451 1:16682006-16682028 GAGGTTTTGAATGACCTTGTTGG + Intergenic
903151333 1:21411751-21411773 GAGGTTTTGAATGACCTTGTTGG + Intergenic
904799090 1:33080478-33080500 GACATTATACAGGACTTTGATGG + Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905400160 1:37695786-37695808 TAGATGGTGAAGGTCCTTGAAGG + Intronic
905726235 1:40254106-40254128 CAGGTAATGAAGGACCTCGAAGG + Intergenic
905807326 1:40886299-40886321 GGGCTTGTGGAGGACCTTGAAGG - Intergenic
906100292 1:43255975-43255997 CAGATTGTGCAGGACCGTGAAGG + Intronic
906175767 1:43770931-43770953 CAGAATATGAAGGGCCTTGTAGG - Intronic
906187609 1:43872835-43872857 GAGATTGGGAAAGACCTTCATGG + Intronic
906739083 1:48163472-48163494 GAGATAATGCAGGATATTGAAGG + Intergenic
908046466 1:60175243-60175265 GAGATGATGAAAAACTTTGAGGG - Intergenic
908155731 1:61350660-61350682 GAGGTTATGAAGGATCTGGCAGG - Intronic
910110101 1:83673823-83673845 GAGATAATTTAGGACCTTCAAGG + Intergenic
911738853 1:101365351-101365373 GAGCTCATGGAGGACCTAGAAGG + Intergenic
911781355 1:101883549-101883571 GACATTATCAAGGACATTAAGGG - Intronic
912402026 1:109402011-109402033 GAGGTTATCAAGGACATTTAAGG - Exonic
912734458 1:112137815-112137837 TAGATTATAAAAGACCTTGAAGG - Intergenic
912734503 1:112138271-112138293 TAGATTATAAAGGACCTTGAAGG - Intergenic
913617411 1:120575661-120575683 CAGATTTTCAAGGACCTGGAAGG - Intergenic
914572863 1:148935259-148935281 CAGATTTTCAAGGACCTGGAAGG + Intronic
914579246 1:149005125-149005147 GAGGTTTTGAATGACCTTGTTGG - Exonic
915862462 1:159459965-159459987 GAGATTACGAAGTAATTTGATGG - Intergenic
916984574 1:170176979-170177001 AAGATTATGTAGGATCTTGTAGG + Intergenic
917621803 1:176803690-176803712 GAGAGAATGAAGGAAATTGATGG - Intronic
917772135 1:178291267-178291289 TAGGTAATGAAGAACCTTGAAGG + Intronic
918113088 1:181475421-181475443 GAGATTATGAAAGGCTTTGTGGG + Intronic
920533926 1:206724927-206724949 GAGTTTCTGAAGCACCTTCAAGG + Intronic
921124477 1:212164883-212164905 TAGATTAAACAGGACCTTGAAGG - Intergenic
921644893 1:217602579-217602601 GAGATAATGAGGGACCATGGAGG + Intronic
922135707 1:222823974-222823996 GAGATTACTGAGGACCTGGAGGG - Intergenic
922366708 1:224872039-224872061 CAGATTCTGCAGGGCCTTGAAGG + Intergenic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
922945593 1:229511140-229511162 GAGACCATGAAGGGCCTTGTAGG + Intergenic
923881222 1:238105782-238105804 TGGATTAGGGAGGACCTTGAAGG + Intergenic
924654178 1:245958320-245958342 CAGATTGTGAAGGGCCTTCATGG - Intronic
1062923190 10:1295287-1295309 AAGATTTTGCAGCACCTTGAAGG - Intronic
1063304158 10:4881036-4881058 GAGAATATGCTGGACATTGAAGG - Intergenic
1066253642 10:33657410-33657432 CAGATTATAATGGACTTTGATGG - Intergenic
1068297391 10:55090723-55090745 GAGATTTTGAAGAACTGTGAAGG + Intronic
1072005674 10:91244462-91244484 CAGATTATGAAGGGCCATGTAGG + Intronic
1072272497 10:93790425-93790447 GCGATGATAAAGGACTTTGACGG + Intronic
1073401548 10:103261547-103261569 CAGATTATCAAGGACCTCAAAGG + Intergenic
1074038651 10:109766261-109766283 CAGATTTTCAAGGACCTTGGAGG - Intergenic
1075357025 10:121788805-121788827 GAGAATATCAAGGAACTTTAAGG + Intronic
1075490309 10:122861929-122861951 CAGATTATGAAGGTCCGTGTAGG - Intronic
1077661205 11:4070139-4070161 AAGATGATGAAGGACTTGGAGGG + Exonic
1077883965 11:6372131-6372153 TAAATTATGAAGGGCTTTGAAGG - Intergenic
1078160775 11:8837905-8837927 GAGTTTATGAAGGAGGTGGAAGG + Intronic
1079281499 11:19090900-19090922 CAGGCCATGAAGGACCTTGAAGG - Intergenic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1085336182 11:75698241-75698263 AAGGTTATGCAGGGCCTTGAAGG - Intergenic
1085851453 11:80124836-80124858 GAGATTATGTTGGATCTTTAAGG + Intergenic
1086194648 11:84122768-84122790 GAGATTATAAAAAACCTTCAAGG - Intronic
1087238376 11:95747452-95747474 GAGATTATTATGGTCTTTGAAGG - Intergenic
1088609265 11:111561641-111561663 GAGATTATGAAGCTGATTGAGGG - Intronic
1088673685 11:112168971-112168993 CAGATAATACAGGACCTTGAAGG + Intronic
1089611995 11:119674475-119674497 GACAGTATGATGTACCTTGAAGG - Intronic
1090988141 11:131791556-131791578 AAGATTGTGAAGGAGCCTGAGGG - Intronic
1091182869 11:133622601-133622623 CAGATTATGAAGGACTTTATAGG - Intergenic
1091203308 11:133799574-133799596 CAGATTTTGAAGGATCTTGAAGG + Intergenic
1091461808 12:648731-648753 CAGATCATGATGGACCCTGAAGG - Intronic
1093286848 12:17274413-17274435 TTGATTGTGAAGGGCCTTGAAGG + Intergenic
1093547405 12:20365379-20365401 AAGATCATGAAGGTCCTTGTAGG + Intergenic
1094055506 12:26265432-26265454 TAGATCATGAAGGACCTTGCAGG + Intronic
1094769368 12:33636467-33636489 AAGATTATGGGAGACCTTGAAGG + Intergenic
1095693659 12:45119452-45119474 GAGACTATGAATGACCTCGGGGG - Intergenic
1096067833 12:48755201-48755223 GAGACTATGAAGGACATGTAGGG - Intergenic
1096201734 12:49688410-49688432 CAGATTATGTGGGACCTTGTTGG - Intronic
1097834560 12:64260112-64260134 GAGGTCATTAAGGGCCTTGAAGG + Intergenic
1098504198 12:71230197-71230219 GAAATTAAGAAGGAAATTGAAGG + Intronic
1098565279 12:71928145-71928167 GACATTCAGAAGTACCTTGATGG - Intergenic
1099684522 12:85867509-85867531 GAGATCATGAAGAACCTAAATGG - Intergenic
1099932272 12:89088159-89088181 GAGATTATGTGGGTCCTTGTTGG + Intergenic
1100085070 12:90900780-90900802 GAGATTGTGAAGGATCTTACAGG + Intergenic
1100526843 12:95427511-95427533 CAGATTATGAAAGACCTCGGAGG - Intergenic
1100585237 12:95973281-95973303 GAGAAGATAAAGGACCTTCAGGG - Exonic
1101451762 12:104786174-104786196 GAGATTATGAAGGACCTTGTTGG + Intergenic
1102074587 12:110049566-110049588 GAGATTACAAAGTACCTTAAGGG + Intronic
1103108297 12:118251016-118251038 GGGACCATGAAGGACCTTGTGGG + Intronic
1104752557 12:131249051-131249073 TAGAGTATGAAGGCCCTTGGTGG + Intergenic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1106929243 13:34646089-34646111 CAGATTATGGAGAACCTTGACGG + Intergenic
1107975423 13:45683828-45683850 GAGGTCATGTAGGGCCTTGAGGG - Intergenic
1109339931 13:61043120-61043142 GAGATCATTCAGGACATTGAAGG + Intergenic
1109379335 13:61539273-61539295 GAGATTTTGAAGGATCTTGAAGG + Intergenic
1109482119 13:62969587-62969609 CAGGTTATACAGGACCTTGAAGG - Intergenic
1110027354 13:70557665-70557687 GAGATGATGAAGGACAATGAAGG - Intergenic
1110658000 13:78023525-78023547 CAGATTACAAAGGACCTTGTGGG + Intergenic
1110937409 13:81308053-81308075 CACTTTATGAAAGACCTTGATGG - Intergenic
1114502235 14:23179140-23179162 TAGATTAAGAAGCATCTTGAAGG - Intronic
1115223315 14:31078772-31078794 GTGATTATGCAGGACTTGGACGG + Intronic
1116900220 14:50355416-50355438 GAGATTATGAAGTACTCTGCTGG - Intronic
1119048716 14:71344899-71344921 TGGATTTTGAAGGACCTTAATGG + Intronic
1119564950 14:75620596-75620618 CAGATTATTAAGCTCCTTGAAGG + Intronic
1120067032 14:80054623-80054645 GAGATTATTAAGGAAATTGGAGG - Intergenic
1120231276 14:81844023-81844045 GAGATTATTTTGGACCTTTAAGG - Intergenic
1120991312 14:90379928-90379950 CAGATTATGGAGGGCCCTGAAGG + Intergenic
1121805929 14:96822832-96822854 GAGATCAAGTAGGGCCTTGAAGG - Intronic
1123206258 14:106716135-106716157 GAGAATATGAAGGATATGGATGG - Intergenic
1123211340 14:106763544-106763566 GAGAATATGAAGGATATGGATGG - Intergenic
1126068444 15:44844694-44844716 CTGATTATGGAGGATCTTGAAGG - Intergenic
1126090386 15:45046112-45046134 CTGATTATGGAGGATCTTGAAGG + Intronic
1126635972 15:50780172-50780194 CAGATTATGAAAGGCCTAGAAGG + Intergenic
1126747803 15:51844262-51844284 TAGATTTGGAAGGACCTTGGAGG + Intronic
1127715946 15:61649613-61649635 AAGAATAAGAAGGACCTTCATGG - Intergenic
1128516560 15:68345634-68345656 GAGATACTGAAGGAGCCTGAGGG - Intronic
1130246005 15:82249819-82249841 GAGATAGTGTATGACCTTGATGG + Intronic
1130358684 15:83159852-83159874 CAGATTATTTAGGGCCTTGAAGG + Intronic
1130454677 15:84093461-84093483 GAGATAGTGTATGACCTTGATGG - Intergenic
1130898942 15:88192627-88192649 CAGCTTGTGCAGGACCTTGAGGG - Intronic
1133079072 16:3304363-3304385 GAAATTATAAAAGACCTTGAGGG - Intronic
1134036155 16:11032830-11032852 CAGGTCATGAAGGGCCTTGAAGG + Intronic
1134306582 16:13038382-13038404 TAGATTGTGCAGGACCTTGTGGG - Intronic
1135199154 16:20421533-20421555 CAGCTTAGGAAGGATCTTGATGG + Intronic
1135219542 16:20602144-20602166 CAGCTTAGGAAGGATCTTGATGG - Intergenic
1136588879 16:31205072-31205094 GAGGTTGGCAAGGACCTTGAAGG - Intergenic
1138874389 16:60931529-60931551 GAGATTGTGTAGGACCTTGAAGG + Intergenic
1139528818 16:67531609-67531631 CAGATTCTGAAGAACCTTGCAGG + Intronic
1139739250 16:69021172-69021194 TAGATCATGAAGGGCCTTGCAGG - Intronic
1140540634 16:75753552-75753574 GAGATTATGAGGGACTTTCATGG - Intronic
1140565078 16:76032223-76032245 GCCATTATGAAGGAACTTGATGG + Intergenic
1140965103 16:79958369-79958391 GAGACCATGAAGGAGCATGAGGG + Intergenic
1141149952 16:81557226-81557248 GAGATCATGAAGCTCCATGAAGG + Intronic
1142354678 16:89596867-89596889 GAGATCATGAGGGACTTGGAGGG + Exonic
1143963324 17:10738506-10738528 GAGATAATGAAGGCCAATGAGGG + Intergenic
1146026349 17:29324899-29324921 GAAATTATGAAGTATTTTGAGGG + Intergenic
1146223503 17:31047077-31047099 GAGATAAAGAAGGCCCTGGAAGG + Intergenic
1146227052 17:31076154-31076176 AAGAGTATGAAGGACTCTGATGG + Intergenic
1146410429 17:32578923-32578945 CAGATTGTCAAGGAACTTGAAGG - Intronic
1148942932 17:51230757-51230779 CAGATTATGAGGGCCCTTGTAGG + Intronic
1150327409 17:64268200-64268222 GGGATGATGAAGGGCTTTGAGGG + Intergenic
1152381937 17:79946685-79946707 GAGCTGATGGAGGGCCTTGAAGG - Intronic
1152506312 17:80751264-80751286 GAGATTCAGAAGGACCCAGATGG + Intronic
1152979751 18:265871-265893 AACATTATCAAGGACCTTGAGGG - Intronic
1154955977 18:21255127-21255149 CAGATTATGAAGAGCCTTGAAGG - Intronic
1155579917 18:27292235-27292257 TAGATTATGAAAGACTTTTAAGG + Intergenic
1156809684 18:41232408-41232430 CAGATTATGTAGGGCCTTGTGGG - Intergenic
1157649386 18:49312625-49312647 GAGGATATGCAGGACATTGAAGG - Intronic
1160321695 18:77902251-77902273 TAAATTATGAAGGATCTTTATGG + Intergenic
1161122607 19:2537770-2537792 GAAATTATGAAAGGTCTTGAGGG + Intronic
1161541026 19:4851676-4851698 GAGGTTGTGCAGGACCTTGTGGG + Intronic
1167193611 19:48009960-48009982 GAGAGTCTGGAGGACCTTGGAGG + Intronic
925183529 2:1831982-1832004 GAGATTCTGTGGGACTTTGAAGG - Intronic
926524029 2:13953717-13953739 GAGATGAAAAAGAACCTTGAAGG - Intergenic
929263188 2:39889554-39889576 CATATTGTGAAAGACCTTGAAGG - Intergenic
929642355 2:43594631-43594653 CAGATTATTTAGGGCCTTGAAGG - Intronic
930698679 2:54437801-54437823 AACATTATAAAGGACCTTCATGG + Intergenic
931294294 2:60906514-60906536 CAGATTATGAAGGGCTTTAAAGG - Intronic
931319026 2:61158313-61158335 AAGACTATGAAAGACCTTGGGGG + Intronic
931339211 2:61382280-61382302 CAGATTATTCAGGACCTTGTAGG - Intronic
931972392 2:67603350-67603372 CAGAATATGAAAGACATTGAAGG - Intergenic
932066112 2:68562778-68562800 GAGATTATGAAGGACCTTGAAGG + Intronic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
933453351 2:82487867-82487889 GAGATCATGAAGGACAGTGAGGG + Intergenic
937527580 2:122789293-122789315 GAGATTATGTTGGAGCTTTAAGG + Intergenic
939706520 2:145460276-145460298 TAAATTATGCAGGACCTTGTGGG + Intergenic
940237161 2:151524251-151524273 GAGATTATAAAAGACCTTGCAGG - Intronic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
942866557 2:180682912-180682934 GAGATAATAAAGTACCTTGCAGG - Intergenic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944865711 2:203859410-203859432 GAGAATATGAAGGCCCAGGAAGG - Intergenic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
947025086 2:225728766-225728788 GAGATTATGGATGACATTAACGG + Intergenic
1168758824 20:334639-334661 AAGAGTGAGAAGGACCTTGAAGG + Intergenic
1169097297 20:2913676-2913698 GAAATTATGTAGTACCTGGATGG - Intronic
1170301539 20:14889730-14889752 CAGATTATGTAGGGCCTTGGAGG + Intronic
1172012695 20:31855475-31855497 TAGATCATGAATGTCCTTGAAGG + Intronic
1172270377 20:33652095-33652117 AAGATAATTAAGGACCTTCAGGG + Intergenic
1173053649 20:39589684-39589706 GAGATTGTGAAGGTCTTTGATGG + Intergenic
1173749401 20:45465037-45465059 AAGATCATGAAGGACCCTGAAGG - Intergenic
1173829558 20:46072540-46072562 AAGATTATACAGGACCTTCATGG - Intronic
1174679862 20:52395872-52395894 AAGTTTATGAAGGAGCTCGAAGG + Intergenic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1177968289 21:27757196-27757218 ATGATTATGAAGGACCTAGCTGG + Intergenic
1179609475 21:42540534-42540556 GAGATCATGAAGGTGCTAGAAGG + Intronic
1181757292 22:25033026-25033048 ACCACTATGAAGGACCTTGAAGG - Intronic
1183237503 22:36630568-36630590 GAGGTCATGAAGGACCCTGTTGG + Intronic
953655994 3:44855276-44855298 GAGATTACAAAGAACCTTAAGGG + Intronic
953839130 3:46374691-46374713 TAGATCATGAAGAACCTTGACGG + Exonic
954615054 3:51965246-51965268 TGGATCATGAAGGTCCTTGATGG - Intronic
956912532 3:73833780-73833802 GAGTAAATGAAGGACCCTGAAGG + Intergenic
958693407 3:97497435-97497457 TAGTTTATGAAGGACCTGAAAGG - Intronic
959284811 3:104393966-104393988 GAGTTATTGAAAGACCTTGAGGG - Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
960224587 3:115154840-115154862 GAGACAAAGAAGGACCTTGGTGG - Intergenic
960810498 3:121623164-121623186 GAGATTTTGAAGTACATTGCTGG + Exonic
961253460 3:125525648-125525670 GAGATTATAAAGAAACTTAAGGG + Intergenic
963761377 3:149289684-149289706 CAAATTATGAAGGACTATGATGG + Intergenic
964361117 3:155897501-155897523 GGTATTATGAAGGCCCTGGATGG - Intronic
965247887 3:166298937-166298959 GAGATCGTGCAGGACCTTTAAGG - Intergenic
965862407 3:173162548-173162570 GAGATATTTAAGGACCCTGAAGG - Intergenic
966045206 3:175540436-175540458 CAGATTTTGTAGGACCTTGGAGG + Intronic
967425781 3:189325589-189325611 GAGATTAGAAAGGATCTTAAAGG + Intergenic
967824184 3:193865655-193865677 GGGATTATGAAGGGCCTTAAAGG - Intergenic
967866413 3:194193680-194193702 CAGGTCATGAAGGACCTAGACGG + Intergenic
970113999 4:12672295-12672317 GAGGTTATGAAGGTCCTTTATGG - Intergenic
971379151 4:26081040-26081062 GAGATCATCAAGGGCCCTGAGGG + Intergenic
971545402 4:27879642-27879664 GAGATTATTTTGGAGCTTGAAGG - Intergenic
971863654 4:32141015-32141037 GAGATTATACAGGAGATTGAAGG - Intergenic
972253912 4:37333262-37333284 GTGGTTATCAAGGGCCTTGATGG + Intronic
973103274 4:46297946-46297968 GAAATTATAAAATACCTTGAGGG - Intronic
976872329 4:89810413-89810435 AACATTATGAAAGGCCTTGAGGG + Intronic
977567982 4:98600775-98600797 TGGATCATGAAGGACCTTAATGG + Intronic
980178593 4:129376569-129376591 AAGATTATGAAGAACCTTGAAGG - Intergenic
980191504 4:129530557-129530579 AAGATTACACAGGACCTTGAAGG - Intergenic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
982923243 4:161303502-161303524 GAGATGATTAGAGACCTTGAGGG - Intergenic
983972882 4:173895817-173895839 AAGCTTGTGAAGGATCTTGAAGG - Intergenic
984414744 4:179443932-179443954 GAGATTTTGAAGGAAATAGAAGG - Intergenic
986446382 5:7824897-7824919 GAGACTAAGAAAGGCCTTGAGGG - Intronic
987150211 5:15031204-15031226 CAGACTATGGAGGACCTTGAAGG - Intergenic
988984424 5:36602941-36602963 GAGAATATCAAGGCCCTTGAAGG - Intergenic
993409756 5:87559053-87559075 GAGGTTATGCTGGACATTGAAGG - Intergenic
993739123 5:91515620-91515642 GAGATTCTGAAGTACGTTGGAGG + Intergenic
993750769 5:91664643-91664665 AAGTTTATGAAAGACCATGAGGG - Intergenic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
997636542 5:135411213-135411235 GGGATCATGAAGGATCTTGTTGG + Intergenic
1001752877 5:174145058-174145080 GGGACTGTGCAGGACCTTGAAGG + Intronic
1001876343 5:175204875-175204897 GAAATTATGAAAGACTCTGAAGG + Intergenic
1002214175 5:177618050-177618072 GAGATGATGAAGGCATTTGATGG - Intergenic
1003654825 6:7996875-7996897 CTAATTATGTAGGACCTTGAAGG - Intronic
1005381104 6:25235132-25235154 GAGCTTAAGAAAGACCATGAGGG + Intergenic
1007316134 6:40990634-40990656 GAGTTGATGATGGACCTGGAGGG - Intergenic
1007707614 6:43800355-43800377 GGAATCATGTAGGACCTTGAAGG - Intergenic
1008588689 6:52971332-52971354 AAGATTATAAAGACCCTTGAAGG - Intergenic
1008875418 6:56320495-56320517 CAGATTGTGTAGGACCTTGGGGG - Intronic
1009592831 6:65694848-65694870 GAGATTATTAAACACTTTGAAGG - Intronic
1010980754 6:82365767-82365789 GCCATTGTGAAGGACCTTGAGGG - Exonic
1011406251 6:87018280-87018302 GAGATGAAGTAGGAGCTTGATGG - Intergenic
1013439512 6:110148605-110148627 CAGATTAGGTAGGACCTTGAAGG + Intronic
1013548437 6:111183121-111183143 CAGATTGTGAAGGACCTTGTAGG - Intronic
1014143543 6:117971230-117971252 GAGATTATTTTGGAACTTGAAGG - Intronic
1014368625 6:120577230-120577252 CAGATAACAAAGGACCTTGAAGG + Intergenic
1015209959 6:130685771-130685793 GAGATAATGAAGGACCTTGTAGG + Intergenic
1015980729 6:138835800-138835822 GTGATTATAAAGGACATTGCTGG - Intronic
1017365169 6:153627497-153627519 CAGATTATGAAGGGTCTTGTAGG + Intergenic
1018558915 6:165079918-165079940 GTGATTAATAAGTACCTTGAAGG - Intergenic
1019317228 7:392398-392420 GAGGTTGTGAAGGAGATTGATGG + Intergenic
1020759402 7:12249662-12249684 GAGAGCATGAAGGATCTTGTGGG + Intergenic
1021306071 7:19034117-19034139 CAGATTCTGAAGGACCTTTTAGG + Intronic
1021892763 7:25202836-25202858 GAAATGAAGAATGACCTTGATGG - Intergenic
1022807158 7:33833934-33833956 GAGATTAAGATGGCCCTTGAAGG + Intergenic
1023098951 7:36693087-36693109 TAGATTGTGAAGCACCTTGAAGG + Intronic
1030595048 7:111527821-111527843 GAGATTATAAAGGAGCATGTGGG + Intronic
1030745666 7:113162677-113162699 GAGATTGTGCAGGCCCTTGTAGG - Intergenic
1031339680 7:120583710-120583732 GAGATATCAAAGGACCTTGAAGG - Intronic
1031560477 7:123232172-123232194 CAGATTATCCAGGACCTTGTAGG - Intergenic
1031584522 7:123518464-123518486 TAGATCATTTAGGACCTTGAAGG - Intronic
1036125428 8:6057639-6057661 CAGATTAGGAAGGACCTGGTAGG - Intergenic
1038312155 8:26453041-26453063 AAGATTTTGAATGACCTTGCAGG + Intronic
1039969222 8:42307325-42307347 CAGATTATGAAGGGCCTTCAGGG + Intronic
1040524949 8:48213588-48213610 GCTATTATAAAGGGCCTTGATGG + Intergenic
1040821876 8:51568890-51568912 GAAATTAAGAATGACTTTGATGG - Intronic
1041773996 8:61504243-61504265 GAGTTTATGAGGGACACTGATGG + Intronic
1042868811 8:73379040-73379062 GAGATTATGAAACTCCCTGATGG + Intergenic
1042900659 8:73723607-73723629 AAAATTATGAATGAACTTGAAGG - Intronic
1043207906 8:77470867-77470889 AAGATCAGGTAGGACCTTGAAGG + Intergenic
1043966904 8:86488778-86488800 GAAATTAGGAAGAACCTAGATGG + Intronic
1044155581 8:88841944-88841966 GAATTTATGAAGGACGTTTAAGG - Intergenic
1046315249 8:112492514-112492536 GAGATGATGGAAGACCTGGATGG - Exonic
1046320647 8:112569771-112569793 GAGATTAGGAAGAACATTCAAGG - Intronic
1051068547 9:13134887-13134909 GAGACTATGAAGAACCAGGAGGG - Intronic
1052149265 9:25093404-25093426 GAAATTATGATGGAACTTGAAGG + Intergenic
1057582994 9:96304141-96304163 GAGATAATCAATGACCATGAAGG - Intergenic
1057762582 9:97888722-97888744 GAGATTTAGAAGGAGCTGGAGGG + Intergenic
1057824267 9:98360129-98360151 GAGATGATGAAAGACCTTTGTGG - Intronic
1058934184 9:109752648-109752670 CATATTATGAAGGACCTTGAAGG + Intronic
1059164238 9:112063574-112063596 GTGATTATAAAGGATATTGAAGG - Intronic
1059917027 9:119115332-119115354 CAGATCATGAAGAACCTTCATGG - Intergenic
1060104527 9:120865548-120865570 GGGATTAGGAAGGCCCTTAAAGG + Intronic
1060582441 9:124762178-124762200 AAAATTATGAAGGACCCTAAAGG + Intronic
1060768665 9:126314429-126314451 GAGGCTATGGAGGACCTTGAAGG + Intergenic
1061401891 9:130373070-130373092 GAGGTGATCAAGGTCCTTGATGG + Intronic
1186368819 X:8925808-8925830 GAGATTACGTAGGAGCTGGAAGG + Intergenic
1186558159 X:10582726-10582748 GGGACTATGAAGGACATTAAGGG - Intronic
1190019938 X:46864893-46864915 GAGATAATGAAGGGCCTTGTAGG + Intronic
1190468692 X:50753300-50753322 GAGACTCTGAAGGAGCTTGAAGG + Intronic
1190616537 X:52239647-52239669 GAGAGTATGAAGTCCCTGGAGGG - Intergenic
1192340777 X:70261663-70261685 CAGATCATGAAGGTCCTTGGAGG + Intergenic
1192627783 X:72748047-72748069 GAAATTAAGAAGGACAATGAAGG + Intergenic
1192653925 X:72972762-72972784 GAAATTAAGAAGGACAATGAAGG - Intergenic
1194548515 X:95268905-95268927 GAGATTATTATGGAACTTTAAGG - Intergenic
1195408582 X:104544271-104544293 CAGATCATAAAGGACCTTGTGGG - Intergenic
1196017824 X:110958228-110958250 GAGACCATGCAGAACCTTGAAGG + Intronic
1196141535 X:112268108-112268130 CAGATTAGGTAGGATCTTGAAGG - Intergenic
1197098869 X:122627768-122627790 AAGATTATGTAAGGCCTTGAAGG - Intergenic
1199084922 X:143617418-143617440 TAGATTCTGAAGGGTCTTGAAGG - Intergenic
1199683240 X:150241981-150242003 GAGGTTTTAAAGGACTTTGAAGG - Intergenic
1200381875 X:155845767-155845789 GAGATTATGTAGTCCCTTGGAGG - Intergenic