ID: 932067630

View in Genome Browser
Species Human (GRCh38)
Location 2:68583266-68583288
Sequence TAGGGTAGTAAAGCTGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932067630_932067633 -1 Left 932067630 2:68583266-68583288 CCTGCAACAGCTTTACTACCCTA 0: 1
1: 0
2: 0
3: 7
4: 66
Right 932067633 2:68583288-68583310 ATTTATCTTCTCCCCTTAACAGG 0: 1
1: 0
2: 3
3: 65
4: 1103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932067630 Original CRISPR TAGGGTAGTAAAGCTGTTGC AGG (reversed) Intronic
906551005 1:46666442-46666464 CTGGGCAGTGAAGCTGTTGCTGG + Intronic
915414084 1:155726586-155726608 TAGGAAAGTAAAGCTGAGGCCGG - Intronic
1063429824 10:5978176-5978198 TAGGGGAGCAAAGCTGCAGCAGG - Intronic
1064376236 10:14798973-14798995 GAGGGTAGAAAAGTGGTTGCTGG + Intergenic
1065540038 10:26754767-26754789 TATGCTAGAAAAGCTGTTGATGG - Intronic
1066093415 10:32049127-32049149 AATGGTTGAAAAGCTGTTGCAGG - Intronic
1067281153 10:44874215-44874237 TATGTTATTAAAGCTGTTTCAGG + Intergenic
1075608240 10:123831805-123831827 TAGGGTAGAAAAGATTTTTCTGG - Intronic
1089918514 11:122183976-122183998 TAGGGTAGTAATGCTGCTTGGGG - Intergenic
1091112675 11:132984748-132984770 TAGTGTCTTCAAGCTGTTGCTGG - Intronic
1093082598 12:14830377-14830399 TAAGGTAGAAAAGATGTTTCTGG + Intronic
1096113398 12:49041556-49041578 TAGGGCAGTCAGGCTGCTGCAGG + Intronic
1097967022 12:65592172-65592194 TAGGGAAGGAAATCTGTTCCTGG + Intergenic
1099307736 12:80979198-80979220 TAGAATAGTAAAGCTGTACCAGG - Intronic
1099566125 12:84248732-84248754 TATGGTAATAAAGCTGTTGTTGG - Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1102410821 12:112716744-112716766 TAGGGGAGGAAAGATGTTGGGGG + Intronic
1102433921 12:112905555-112905577 TAAGGTAGTGAAACTCTTGCAGG + Intergenic
1104374285 12:128250305-128250327 TAAGTGAGTAAAGCTGTTGCAGG + Intergenic
1108418882 13:50228617-50228639 TAGGGCAGTAGGGCTGCTGCAGG - Intronic
1108863109 13:54886828-54886850 TTGGAGTGTAAAGCTGTTGCAGG - Intergenic
1110495360 13:76161738-76161760 CAGTGTAGTAAAGCTGTTGAAGG - Intergenic
1111880929 13:93956145-93956167 TGGGGTATTATAGCAGTTGCAGG - Intronic
1112203404 13:97300680-97300702 TAGTGGAGTAAAGATGTTGAAGG - Intronic
1114382060 14:22217103-22217125 TTGGGTAGTAGTGCTGTTGCTGG - Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1121136375 14:91502561-91502583 TAGGGTGGAAAAGCTTTTGGGGG - Intronic
1124149675 15:27166497-27166519 TAGGGTAATAAAGGTCTTGCAGG + Intronic
1126196484 15:45937296-45937318 TGGGGCAGTAAAGCAGTTGGAGG - Intergenic
1139751920 16:69114140-69114162 TAGGGAGGTAGAGCTGGTGCTGG + Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1153147492 18:2050377-2050399 CAGGCTAGTAAAGCTATGGCTGG + Intergenic
1167633131 19:50638288-50638310 TAGGGTAGGAAAGCAGTTGGAGG + Intronic
927314132 2:21662583-21662605 TATGGTTGTAGGGCTGTTGCTGG + Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
933878994 2:86649067-86649089 TAGGGAGGTAGAGCTGATGCAGG + Intronic
1172344846 20:34190026-34190048 TGGGTTAGAAAGGCTGTTGCGGG - Intergenic
1175488143 20:59360206-59360228 TGGGGTTGTAAATCTCTTGCTGG + Intergenic
1178934234 21:36847461-36847483 TAGGATAGTAAATAAGTTGCTGG - Intronic
949298523 3:2555827-2555849 TATGGTAATATAGCTGTGGCTGG + Intronic
951541067 3:23782404-23782426 TAAGGTAGCAAAGCTGTTTTGGG + Intergenic
957785524 3:84877322-84877344 TAAGGTACAAAAGCTGTCGCTGG + Intergenic
966595816 3:181724012-181724034 TAGGGTCGTGAAGATGCTGCGGG + Intergenic
974802799 4:66840448-66840470 TAGGGAAGTAAATCTTTTGGAGG + Intergenic
980873018 4:138631819-138631841 TTGGATAGTAAATCTGTTGAGGG + Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
984916864 4:184733256-184733278 TAGGGTGGAAAAGCTGGAGCAGG - Intronic
985139989 4:186830112-186830134 TAGGGAAATAAAGCAGTAGCTGG - Intergenic
990644180 5:57825126-57825148 TAAAGTAGAAAAGCAGTTGCTGG + Intergenic
993007229 5:82441657-82441679 TAGGGGAGTAAAGGTGGTGGAGG + Intergenic
997926488 5:138035108-138035130 TAGGGTAGGAATGCTGCTGGAGG - Intronic
999185524 5:149704871-149704893 TAAAGTAGTAAAACTGTTTCAGG - Intergenic
999695299 5:154183538-154183560 TAGGGCAGTAAAACTGAGGCAGG + Intronic
1003958344 6:11186914-11186936 TAGAAAAGTAAAGCTGTTGAAGG - Intronic
1008719932 6:54336715-54336737 TAGGTTACTAAAGCTATTACAGG + Intronic
1010985043 6:82413851-82413873 TAGGATATTGAAGCTGTTTCAGG + Intergenic
1013335481 6:109154912-109154934 AAGGGTACTAAAGGTGTAGCAGG - Intronic
1014732068 6:125043984-125044006 TAAGGTAGTTAAGAAGTTGCAGG - Intronic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1016562112 6:145408283-145408305 CTGGGTAGTACAGCTGTTACTGG - Intergenic
1017293656 6:152769993-152770015 CAGGGTATTAAAGCAGTAGCTGG + Intergenic
1017377341 6:153786616-153786638 CAGGGTACTAAAGTTATTGCAGG - Intergenic
1020408748 7:7866853-7866875 TAGGGTAGTAAAGCTGTACATGG + Intronic
1028343269 7:89748367-89748389 TAGGGTGGGAGAGCTGTTGGGGG + Intergenic
1031059535 7:117034968-117034990 GAGGGTAGCAATGCTGTTTCCGG - Intronic
1032652889 7:133898034-133898056 GAGGGTAGAACAGCGGTTGCTGG - Intronic
1038910152 8:31954328-31954350 TAGGATAATAAAGCTTTTACTGG + Intronic
1044870908 8:96619012-96619034 GAGACTAGTAAAGCTATTGCAGG + Intergenic
1046315565 8:112496798-112496820 AAGGGTAGTAGAGGTGTTGGGGG + Intronic
1053424811 9:38003902-38003924 TGGGGTGGTGAGGCTGTTGCTGG + Intronic
1188143239 X:26578175-26578197 TAGAGTAATAAAGCTGGTGAGGG + Intergenic
1188315707 X:28670581-28670603 GAGGGTGGTAGAGCTGTGGCAGG - Intronic
1190427387 X:50345909-50345931 TGGGGGAAGAAAGCTGTTGCGGG + Intronic
1197084292 X:122454185-122454207 TAGGACAGTAAAGGTATTGCTGG + Intergenic