ID: 932067633

View in Genome Browser
Species Human (GRCh38)
Location 2:68583288-68583310
Sequence ATTTATCTTCTCCCCTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1172
Summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 1103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932067630_932067633 -1 Left 932067630 2:68583266-68583288 CCTGCAACAGCTTTACTACCCTA 0: 1
1: 0
2: 0
3: 7
4: 66
Right 932067633 2:68583288-68583310 ATTTATCTTCTCCCCTTAACAGG 0: 1
1: 0
2: 3
3: 65
4: 1103
932067629_932067633 0 Left 932067629 2:68583265-68583287 CCCTGCAACAGCTTTACTACCCT 0: 1
1: 0
2: 1
3: 4
4: 90
Right 932067633 2:68583288-68583310 ATTTATCTTCTCCCCTTAACAGG 0: 1
1: 0
2: 3
3: 65
4: 1103
932067628_932067633 12 Left 932067628 2:68583253-68583275 CCTTAATTCACTCCCTGCAACAG 0: 1
1: 0
2: 1
3: 12
4: 168
Right 932067633 2:68583288-68583310 ATTTATCTTCTCCCCTTAACAGG 0: 1
1: 0
2: 3
3: 65
4: 1103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932067633 Original CRISPR ATTTATCTTCTCCCCTTAAC AGG Intronic
900039188 1:442533-442555 ATTTATGTTCTTCTCTAAACTGG - Intergenic
900060621 1:677509-677531 ATTTATGTTCTTCTCTAAACTGG - Intergenic
901335698 1:8447149-8447171 ATTTATGTTCTTCTCTAAACTGG + Intronic
902741478 1:18441590-18441612 ATCTCTCTTCTCCCATTAACAGG + Intergenic
902964967 1:19994390-19994412 ATTTATGTTCTTCTCTAAACTGG + Intergenic
903566772 1:24273620-24273642 ATTTATGTTCTTCTCTAAACTGG + Intergenic
904066392 1:27755189-27755211 ATTTAGCTTCTCCCCAGACCTGG + Exonic
906558002 1:46729625-46729647 ATTTATGTTCTTCTCTAAACTGG - Intergenic
906604287 1:47154595-47154617 ATTTATGTTCTTCTCTTAACTGG - Intergenic
906649600 1:47503249-47503271 ATTTATGCTCTCACCCTAACTGG - Intergenic
906834904 1:49073101-49073123 ATTTATGTTCTCCTCTACACTGG + Intronic
906842943 1:49159919-49159941 ATTTATGTTCTTCTCTAAACTGG + Intronic
906890533 1:49708409-49708431 ATTTATGTTCTTCTCTAAACTGG + Intronic
906894241 1:49753925-49753947 ATTTATGTTCTTCTCTAAACTGG + Intronic
907015325 1:51006511-51006533 ATTTATGTTCTTCTCTAAACTGG - Intergenic
907565780 1:55431853-55431875 ATTTATGTTCTTCTCTAAACTGG - Intergenic
907595310 1:55714096-55714118 ATTTATTTTCTCACCTACACTGG - Intergenic
907600270 1:55761654-55761676 ATTTATGTTCTTCTCTAAACTGG - Intergenic
907953691 1:59207777-59207799 ATTTATGTTCTTCTCTGAACTGG - Intergenic
908059181 1:60328214-60328236 ATTTATGTTCTTCTCTAAACTGG + Intergenic
908611248 1:65864216-65864238 ATTTATGTTCTTCTCTAAACTGG + Intronic
909384372 1:75037941-75037963 ATTTATGTTCTTCTCTAAACTGG - Intergenic
909415812 1:75403984-75404006 ATTTATATTCTTCCCTAAAGCGG - Intronic
909690001 1:78397093-78397115 ATTTATGTTCTTCTCTAAACTGG + Intronic
910177352 1:84444357-84444379 ATTTATGTTCTTCTCTAAACTGG - Intergenic
910331143 1:86073260-86073282 ATTTATGTTCTTCTCTAAACTGG - Intronic
910627053 1:89317891-89317913 ATTTATGTTCTTCTCTAAACTGG - Intergenic
910827683 1:91427288-91427310 ATTTATGTTCTTCTCTAAACTGG + Intergenic
910940758 1:92531072-92531094 ATTTATGTTCTTCTCTAAACTGG - Intronic
911270798 1:95798511-95798533 ATTTATGTTCTTCTCTAAACCGG - Intergenic
911530825 1:99040849-99040871 ATTTATGTTCTTCTCTAAACTGG - Intergenic
911632806 1:100201188-100201210 ATTTATGTTCTTCTCTAAACTGG - Intronic
911669642 1:100593168-100593190 ATTTATGTTCTTCTCTAAACTGG - Intergenic
911995711 1:104763290-104763312 ATTTATCTTCTCCACAGAATGGG - Intergenic
912006964 1:104916403-104916425 ATTTATGTTCTTCTCTAAACTGG + Intergenic
912150653 1:106854538-106854560 ATTTATGTTCTTCTCTAAACTGG - Intergenic
912189430 1:107320491-107320513 ATTAATCTAATCCCTTTAACAGG + Intronic
912270887 1:108208279-108208301 ATTTATGTTCTTCTCTAAACTGG + Intergenic
912301249 1:108519595-108519617 ATTTATGTTCTTCTCTAAACTGG + Intergenic
912676042 1:111681485-111681507 ATTTATGTTCTTCTCTAAACTGG - Intronic
912966399 1:114240858-114240880 ATTTATGTTCTTCTCTAAACTGG - Intergenic
913108520 1:115638324-115638346 ATTTATGTTCTTCTCTAAACTGG + Intergenic
915061218 1:153187556-153187578 ATTTATCTTCTTCTCCAAACTGG + Intergenic
915663748 1:157425546-157425568 ATTTATGTTCTTCTCTAAACTGG - Intergenic
915688594 1:157662913-157662935 ATTTATGTTCTTCTCTAAACTGG - Intergenic
915758028 1:158282029-158282051 ATTTATGTTCTTCTCTAAACTGG + Intergenic
915981414 1:160422299-160422321 CTTTATCTTCTGCCCTGACCAGG + Intronic
916612664 1:166408783-166408805 ATTTATGTTCTTCTCTAAACTGG + Intergenic
916625468 1:166551295-166551317 ATTTATGTTCTTCTCTAAACTGG + Intergenic
916878590 1:168997453-168997475 ATTTATGTTCTTCTCTAAACTGG + Intergenic
916916241 1:169409174-169409196 ATTTATGTTCTTCTCTGAACTGG - Intronic
917009637 1:170456898-170456920 ATTTATGTTCTTCTCTAAACTGG + Intergenic
917019522 1:170570461-170570483 ATTTATGTTCTTCTCTAAACTGG - Intergenic
917023237 1:170613382-170613404 ATTTATGTTCTTCTCTAAACTGG + Intergenic
917158094 1:172026092-172026114 ATTTATGTTCTTCTCTAAACTGG - Intronic
917163001 1:172079475-172079497 ATTTATATTCTTCTCTAAACTGG + Intronic
917248454 1:173030792-173030814 ATTTATGTTCTTCTCTAAACTGG - Intergenic
917584838 1:176416047-176416069 ATTTATGTTCTTCTCTAAACTGG + Intergenic
917768437 1:178249396-178249418 ATTTATGTTCTTCTCTAAACTGG + Intronic
917915370 1:179695629-179695651 ATTTATGTTCTTCTCTAAACTGG - Intergenic
918195816 1:182220060-182220082 ATTTATGTTCTTCACTAAACTGG - Intergenic
918218950 1:182418298-182418320 ATTTCTCTGCTCCTCTTTACAGG - Intergenic
918353625 1:183684022-183684044 ATTTATGTTCTTCTCTAAACTGG + Intronic
918684553 1:187398101-187398123 ATTTATGTTCTTCTCTGAACTGG - Intergenic
918739192 1:188105586-188105608 ACTTATCTTCCCCCATTAAATGG + Intergenic
918945739 1:191062141-191062163 ATTTATGTTCTTCTCTAAACTGG + Intergenic
918953057 1:191165350-191165372 ATTTATCTGCTCCCCATAAAAGG - Intergenic
920838225 1:209531874-209531896 ATTTCTCATCTCCCCTTCAAAGG + Intergenic
920893060 1:210012444-210012466 ATTGATCTTCTTCCCTTGCCTGG - Intronic
921484719 1:215702666-215702688 ATTTATGTTCTTCTCTAAACTGG + Intronic
921631485 1:217438502-217438524 ATTTATGTTCTTCTCTAAACTGG - Intronic
921942993 1:220862976-220862998 ATTTATATTCTTCTCTAAACTGG + Intergenic
922058145 1:222061843-222061865 ACTTATCTAATCCCCTTCACAGG + Intergenic
922066353 1:222147059-222147081 ATTTATGTTCTTCTCTAAACTGG - Intergenic
922396935 1:225211290-225211312 ATTTATTTTCTTCTCTAAACTGG - Intronic
922692053 1:227700909-227700931 ATTTATGTTCTTCTCTAAACTGG - Intergenic
922716154 1:227873442-227873464 ATTTATATTCTTCTCTAAACTGG - Intergenic
923061098 1:230475482-230475504 ATTTATGTTCTTCTCTAAACTGG + Intergenic
923690758 1:236191196-236191218 ATTTATATTCTCCTCTAAAGTGG + Intronic
923853580 1:237821810-237821832 ATTTATGTTCTCCTCTAATCTGG - Intronic
924629702 1:245724980-245725002 ATTTCTGTTCTTCCCTAAACTGG - Intergenic
924798814 1:247312047-247312069 CTTTATCTTCTCTCCTAAACAGG + Intronic
924822969 1:247512364-247512386 ATTTATGTTCTTCTCTAAACTGG + Intronic
1062870371 10:897264-897286 ATTGTTCTTTTCCCCTCAACTGG - Intronic
1064315349 10:14250458-14250480 CTTAATCTTTTCCCCTTAATTGG - Intronic
1065075859 10:22079173-22079195 ATTTATTTTCTTCTCTAAACTGG + Intergenic
1066140691 10:32501235-32501257 ATTTATGTTCTTCTCTAAACTGG + Intronic
1066159813 10:32715686-32715708 ATTTATGTTCTTCTCTAAACTGG - Intronic
1066204752 10:33177363-33177385 CTTAATCTTCTCTCCTTATCAGG + Intergenic
1066353549 10:34660234-34660256 AATTATCTTCTCCCAATAATTGG - Intronic
1066567610 10:36736678-36736700 TTTTTTCTTATCACCTTAACTGG + Intergenic
1066993344 10:42538565-42538587 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1068085954 10:52374083-52374105 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1068358912 10:55950217-55950239 ATTTATCTTCTCTTCCTTACTGG - Intergenic
1068427307 10:56883620-56883642 ATTTATATTCTTCTCTAAACTGG - Intergenic
1068469815 10:57447332-57447354 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1068992999 10:63170272-63170294 ATTTATTTTCTCCCTTTGAATGG + Intronic
1069139794 10:64809299-64809321 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1069348832 10:67501820-67501842 ATTTATGTTCTCCTCTAAACTGG + Intronic
1069763042 10:70828648-70828670 TTTTAAATTCTGCCCTTAACAGG - Intronic
1070234314 10:74608086-74608108 ATTTATGTTCTTCTCTAAACTGG + Intronic
1071001884 10:80840606-80840628 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1071401639 10:85279243-85279265 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1071975721 10:90954152-90954174 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1072358818 10:94639201-94639223 ATTTATTTTCTTCTCTAAACTGG + Intergenic
1072394567 10:95025617-95025639 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1073560690 10:104494024-104494046 TGATGTCTTCTCCCCTTAACGGG - Intergenic
1074015685 10:109531317-109531339 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1074335328 10:112568702-112568724 TTTTATGTTCTCGCCTTAACTGG + Intronic
1074717942 10:116236825-116236847 ATCTGTCTTCTCCACTAAACAGG + Intronic
1074795362 10:116938019-116938041 ATTTATGTTCTTCTCTAAACTGG + Intronic
1075983769 10:126765896-126765918 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1076326912 10:129631242-129631264 CTCTATTTTCTACCCTTAACGGG - Intronic
1076965404 11:78442-78464 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1077713792 11:4560680-4560702 ATTTATGTTCTTCGCTAAACTGG - Intergenic
1078037830 11:7825851-7825873 ATTTATGTTGTCACCTTAATGGG - Exonic
1078336499 11:10467302-10467324 ATTTATGTTCTTCTCTAAACTGG - Intronic
1078743282 11:14088984-14089006 ATTTATGTTCTTCTCTAAACTGG + Intronic
1078809285 11:14742440-14742462 ATTTATGTTCTTCTCTAAACTGG + Intronic
1079262417 11:18896459-18896481 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1079518071 11:21291127-21291149 ATTTATGTTCTTCTCTGAACTGG - Intronic
1079715053 11:23733187-23733209 ATTTATATTCTTCTCTAAACTGG - Intergenic
1080710187 11:34739080-34739102 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1080977287 11:37357850-37357872 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1081221731 11:40470671-40470693 ATTTATGTTCTTCCCTAAACTGG - Intronic
1081252204 11:40849985-40850007 ATTTATGTTCTTCTCTAAACTGG + Intronic
1082663905 11:55949827-55949849 ATTTTTCTTGGCCCCTTCACTGG - Intergenic
1082876184 11:57991545-57991567 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1083073345 11:60010454-60010476 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1083507166 11:63168452-63168474 ATTTATGTTCTTCTCTAAACTGG - Intronic
1083510362 11:63203442-63203464 ATTTATGTTCTTCTCTAAACTGG - Intronic
1085003524 11:73062574-73062596 ATTTATGTTCTCCTCTACACTGG - Intronic
1085827796 11:79865979-79866001 ATTTATATTCTTCTCTAAACTGG - Intergenic
1085839087 11:79989726-79989748 ATTTATCTTCTCACCAAAACAGG - Intergenic
1086067731 11:82764403-82764425 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1086085898 11:82955220-82955242 ATTTATGTTCTTCTCTAAACTGG + Intronic
1086129347 11:83384256-83384278 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1086181504 11:83956620-83956642 ATTTCTCTTGGCCCCTTCACTGG - Intronic
1086300190 11:85419787-85419809 ATTTATGTTATCCTCTCAACTGG + Intronic
1086312149 11:85547841-85547863 ATTTATATTCTTCTCTAAACTGG + Intronic
1086422054 11:86646336-86646358 ATTTATGTTCTTCTCTAAACTGG - Intronic
1086475603 11:87170141-87170163 ATTTATTTTCTTCTCTAAACTGG + Intronic
1086505442 11:87498984-87499006 ATTTATGTTCTGCTCTAAACTGG - Intergenic
1086608584 11:88726173-88726195 ATTTATGTTCTTCTCTAAACTGG - Intronic
1087305889 11:96488242-96488264 ATTTATGTTCTTCTCTAAACTGG - Intronic
1087596266 11:100258072-100258094 ATTTATGTTCTTCTCTAAACTGG - Intronic
1087695167 11:101368657-101368679 ATTTATGTTCTTCTCTGAACTGG + Intergenic
1087712368 11:101568154-101568176 ATTTATGTTCTTCTCTAAACTGG - Intronic
1087718652 11:101637238-101637260 ATTTATGTTCCTCCCTAAACTGG - Intronic
1087830838 11:102818745-102818767 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1087868401 11:103261985-103262007 ATTTATGTTCTTCTCTAAACTGG - Intronic
1087887910 11:103501785-103501807 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1088066598 11:105727171-105727193 ATTTATCTTCTTCTCTATACTGG - Intronic
1088307383 11:108424190-108424212 ATTTATATTCTTCTCTAAACTGG - Intronic
1089285331 11:117404008-117404030 ATTTATGTTCTTCTCTAAACTGG + Intronic
1089765889 11:120765313-120765335 ATTTATGTTCTTTCCTAAACTGG + Intronic
1090312838 11:125757189-125757211 ATTTATGTTCTCCTCTAAACTGG - Intergenic
1090689011 11:129157364-129157386 ATTTATGTTATCCTCTAAACTGG - Intronic
1090765257 11:129870815-129870837 ATCTATCTTCTCCCTTCTACTGG + Intronic
1090811836 11:130251080-130251102 ATTTATGTTCTTCCGTAAACGGG - Intronic
1091089871 11:132761663-132761685 ATTTATCTTCTTCTCTTAACTGG + Intronic
1091213385 11:133884115-133884137 ATTTATGTTCTGCTCTAAACTGG + Intergenic
1092222831 12:6726872-6726894 ATTCATCTTCTCTCTTCAACTGG - Intronic
1092443034 12:8526540-8526562 ATTTATCTTCCTCTCTAAACTGG + Intergenic
1093335901 12:17904926-17904948 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1093694907 12:22147790-22147812 ATTTATGTTCTTCTCTAAACTGG - Intronic
1093714641 12:22367223-22367245 ATTTATATTCTTCCCTGAACTGG - Intronic
1093835468 12:23823971-23823993 ATTTATGTTCTTCTCTAAACTGG + Intronic
1094139899 12:27170726-27170748 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1094579174 12:31718269-31718291 ATTTATGTTCTTCTCTAAACTGG + Intronic
1094755547 12:33464002-33464024 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1095356561 12:41281502-41281524 ATTTATGTTCTTCTCTAAACTGG - Intronic
1095406436 12:41871441-41871463 ATTTATGTTCTTCCCTGAACTGG - Intergenic
1095488640 12:42709470-42709492 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1095679805 12:44960759-44960781 ATTGGGCTTCTCCCCTTCACAGG + Intergenic
1095770428 12:45949140-45949162 TTTTATAGTCTCTCCTTAACTGG - Intronic
1095831349 12:46590533-46590555 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1097460619 12:59857416-59857438 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1097737468 12:63197503-63197525 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1097898659 12:64852358-64852380 ATTTATGTTCTTCTCTAAACTGG + Intronic
1097930671 12:65181364-65181386 ACTTATCTTCTGCCATTACCTGG - Intronic
1098053075 12:66474117-66474139 ATTTATGTTCTTCTCTAAACTGG - Intronic
1098151720 12:67554563-67554585 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1098906514 12:76168736-76168758 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1099053320 12:77808031-77808053 ATTTATGTTCTTCTCTCAACTGG + Intergenic
1099235965 12:80083124-80083146 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1099253585 12:80288750-80288772 ATTTATGTTCTTCTCTAAACTGG + Intronic
1099344410 12:81480265-81480287 ATTTATGTTCTTCTCTAAACTGG + Intronic
1099435117 12:82634035-82634057 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1099492197 12:83301036-83301058 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1099523635 12:83693939-83693961 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1099540315 12:83900064-83900086 ATTTATTTTCTTCTCTAAACTGG - Intergenic
1099550895 12:84042610-84042632 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1099878577 12:88438255-88438277 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1100136422 12:91558071-91558093 ATTTATGTTCTTCTCTAAACAGG - Intergenic
1100768592 12:97897148-97897170 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1100996134 12:100303108-100303130 ATTTATGTTCTTCTCTAAACTGG + Intronic
1101472527 12:105012342-105012364 ATTTATGTTCTTCTCTCAACTGG + Intronic
1101487855 12:105184114-105184136 ATTTATGTTCTTCTCTAAACTGG + Intronic
1102323581 12:111958632-111958654 ATTTATGTTCTTCTCTAAACTGG - Intronic
1102345425 12:112158062-112158084 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1103878450 12:124147508-124147530 ATTTATCCTCTCCCTTTACAAGG - Intronic
1105316615 13:19271115-19271137 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1105645659 13:22315299-22315321 ATTTATGTTCTCCTCTAAACTGG + Intergenic
1105737238 13:23284461-23284483 ATTTATGTTCTTCTCTAAACTGG + Intronic
1105766939 13:23569233-23569255 ATGTAACTTCCCTCCTTAACTGG - Intergenic
1105769558 13:23595394-23595416 ATTTATGTTCTTCTCTAAACTGG - Intronic
1105894505 13:24706876-24706898 CTTTATCTTTTCCCCTAAATGGG + Intronic
1106335874 13:28783055-28783077 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1106336455 13:28788040-28788062 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1106378667 13:29215217-29215239 ATTTATGTTCTTCTCTAAACTGG + Intronic
1106391017 13:29336040-29336062 ATTTATGTTCTTCTCTAAACTGG + Intronic
1106434478 13:29711716-29711738 ATTTACATTCTCCCCTTTCCAGG - Intergenic
1106435290 13:29718139-29718161 ATTTTTCTTCTCTCCTTCAAAGG - Intergenic
1106650990 13:31689570-31689592 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1106983721 13:35320947-35320969 ATTTGTGTTCTTCCCTAAACCGG + Intronic
1107325683 13:39239881-39239903 ATTTATATTCTTCTCTAAACCGG + Intergenic
1107641813 13:42452021-42452043 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1107673940 13:42775801-42775823 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1108153924 13:47565203-47565225 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1108235194 13:48395514-48395536 ATTTATGTTCTTCTCTAAACTGG - Intronic
1108304748 13:49119624-49119646 ATTTATGTTCTTCTCTAAACTGG - Intronic
1108383991 13:49880997-49881019 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1108571218 13:51753641-51753663 ATTTATTTTTTCCCCTTTATTGG + Intronic
1108585868 13:51869364-51869386 AATTATCTTGTCCCTTTAAACGG + Intergenic
1108998445 13:56764422-56764444 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1109204794 13:59469208-59469230 ATTTATTTTGTCCCTTTAATTGG - Intergenic
1109207973 13:59502813-59502835 ATTTGTATTATCCCCTTAAGTGG + Intergenic
1109328784 13:60901615-60901637 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1109457322 13:62610348-62610370 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1109615556 13:64829307-64829329 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1109635398 13:65108749-65108771 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1109661486 13:65466465-65466487 ATTTATTTTCTTCTCTAAACTGG + Intergenic
1109891314 13:68617944-68617966 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1110201603 13:72857187-72857209 AATTTTCTTTTCCCCTTAGCTGG - Intronic
1110631089 13:77709049-77709071 ATTTATGTTCTTCCCTGAACTGG - Intronic
1110824818 13:79959376-79959398 ATTTATATTCTTCTCTAAACTGG - Intergenic
1110836793 13:80092945-80092967 ATTTATGTTCCTCCCTAAACTGG + Intergenic
1110890429 13:80690929-80690951 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1111047088 13:82828794-82828816 ATTTTTCTTTACCCCTTCACTGG + Intergenic
1111628103 13:90814487-90814509 ATTTATGTTCTTCTCTAAACAGG - Intergenic
1111635209 13:90893936-90893958 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1112147138 13:96712356-96712378 ATGTCTCTTCTCTCCTTTACCGG - Intronic
1112152068 13:96774466-96774488 ATTTATGTTCTTCTCTAAACTGG - Intronic
1113057789 13:106288182-106288204 ATGTAGCTTCTCCCGTTTACTGG + Intergenic
1114005256 14:18306148-18306170 TTTTTTCTTATCACCTTAACTGG + Intergenic
1114342090 14:21755358-21755380 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1114710210 14:24769738-24769760 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1114745130 14:25138008-25138030 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1115124339 14:29973624-29973646 ATTTATGTTCTTCTCTAAACTGG - Intronic
1115162198 14:30409324-30409346 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1115281369 14:31667406-31667428 ATTTATCTTCTTCTCTAAACTGG + Intronic
1115282107 14:31675670-31675692 ATTTTTCTTCTCCCCATAAATGG - Intronic
1115295102 14:31816966-31816988 ATTTATGTTCTTCTCTAAACTGG - Intronic
1115511418 14:34140924-34140946 ATTTATGTTCTTCTCTAAACTGG - Intronic
1115538202 14:34392799-34392821 ATTTATTTTCTTCTCTAAACTGG - Intronic
1115720954 14:36161075-36161097 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1115842595 14:37489305-37489327 ATTTATGTTCTTCTCTAAACTGG + Intronic
1115856120 14:37631970-37631992 ATTTATGTTCTTCTCTAAACTGG + Intronic
1115912020 14:38267798-38267820 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1115927350 14:38449976-38449998 TTTTATCTTCTTCTCTAAACTGG - Intergenic
1116262314 14:42646209-42646231 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1116273219 14:42799123-42799145 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1116362797 14:44023104-44023126 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1116424855 14:44778596-44778618 TGTTATCTTCTCCCCTTGAATGG + Intergenic
1116511895 14:45756592-45756614 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1116565546 14:46439760-46439782 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1116775857 14:49179759-49179781 ATTTATTTTCTTCTCTAAACTGG - Intergenic
1116781923 14:49245416-49245438 ATTTATATTCTCCTCTAAACTGG - Intergenic
1116792388 14:49353416-49353438 ATTTATCTTCTTCTCTAAACTGG + Intergenic
1117104421 14:52383434-52383456 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1117121218 14:52569578-52569600 ATTTATGTTCTTCTCTAAACTGG - Intronic
1117299105 14:54406695-54406717 ATTTATGTTCTTCTCTAAACTGG + Intronic
1117502219 14:56364430-56364452 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1117576106 14:57099896-57099918 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1117616935 14:57543941-57543963 ATTTATATTCTTCTCTAAACTGG + Intergenic
1117710858 14:58526989-58527011 ATTTATGTTCTTCTCTAAACTGG - Intronic
1117849929 14:59957484-59957506 ATTTATGTTCTTCTCTAAACTGG + Intronic
1118266844 14:64302693-64302715 ATTTATCATCCCCACTTTACAGG + Intronic
1118498592 14:66334033-66334055 ATTTATATTCTTCTCTAAACTGG - Intergenic
1118515944 14:66529320-66529342 ATTTATGTTCTTCTCTAAACTGG + Intronic
1118544856 14:66874542-66874564 ATTTATGTTCTTCTCTAAACTGG - Intronic
1118786583 14:69050676-69050698 ATTTATTTGTTCTCCTTAACAGG - Intergenic
1119018329 14:71083704-71083726 ATTTATGTTCTTCTCTAAACTGG + Intronic
1120073540 14:80130202-80130224 CTTTATCTTCTCCAATTAACTGG - Intergenic
1120137408 14:80885914-80885936 ATTTATGTTCTTCTCTAAACTGG - Intronic
1120507577 14:85371789-85371811 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1120565197 14:86047190-86047212 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1120843021 14:89103673-89103695 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1121145679 14:91579936-91579958 ATTTTCCTTGACCCCTTAACAGG - Intergenic
1121721791 14:96114463-96114485 CCTTATCTGCTCCCCTTCACAGG - Intergenic
1202842718 14_GL000009v2_random:137915-137937 ATTTATATTCTTCTCTAAACTGG + Intergenic
1202912111 14_GL000194v1_random:128156-128178 ATTTATATTCTTCTCTAAACTGG + Intergenic
1202880502 14_KI270722v1_random:54472-54494 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1123884401 15:24710097-24710119 ATTTATCTTCTTCTTTGAACTGG - Intergenic
1124084340 15:26532642-26532664 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1124370144 15:29099898-29099920 ATTTCTCATCTCTCCTTCACAGG - Intronic
1124894096 15:33759431-33759453 ATTTATGTTCTTCCCTAAACTGG - Intronic
1125082956 15:35697123-35697145 ATTTATTTCCTCCCCTTTGCCGG + Intergenic
1125227307 15:37409433-37409455 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1125288655 15:38121014-38121036 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1125449623 15:39795067-39795089 ATTTATTGTCTCACATTAACTGG + Intergenic
1125784437 15:42302639-42302661 ATTTATGTTCTTCTCTAAACTGG - Intronic
1127452428 15:59130393-59130415 ATTTATGTTCTTCTCTGAACTGG + Intergenic
1127487394 15:59431765-59431787 ATTTTCTTTCTCCCCTTAAGGGG - Intronic
1128852369 15:70972841-70972863 ATTTATGTTCTTCTCTAAACTGG + Intronic
1129173556 15:73822842-73822864 GATTATCATCTCCCCTTGACAGG + Intergenic
1129563356 15:76594111-76594133 ATTTATGTTCTTCTCTAAACTGG - Intronic
1132442722 15:101885079-101885101 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1133956802 16:10451676-10451698 ATTTATATTCTTCTCTAAACTGG + Intronic
1135807696 16:25557427-25557449 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1136287458 16:29252887-29252909 ATTCATCTTCTCCCCGAAAAAGG - Intergenic
1137296467 16:47098312-47098334 ATTTATGTTCTTCTCTAAACTGG - Intronic
1137828245 16:51518065-51518087 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1138151688 16:54662950-54662972 ATTTATATTCTTCTCTAAACTGG - Intergenic
1138650706 16:58459429-58459451 ATGAATCTTCTTCCCTTAGCAGG - Intergenic
1138706327 16:58919527-58919549 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1140165393 16:72544821-72544843 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1140842397 16:78852254-78852276 ATTTCTCTTCTACTCTGAACAGG + Intronic
1146468595 17:33106751-33106773 ATTTTTTTTTTCCCCTAAACAGG + Intronic
1146607992 17:34278317-34278339 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1146766326 17:35524993-35525015 ATTTATATTCTTCTCTAAACTGG - Intronic
1147387292 17:40089995-40090017 ATTTGTCTTCTCCCCTTGCTTGG - Intronic
1148981168 17:51575985-51576007 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1149281129 17:55107292-55107314 ATTTATGTTCTTCTCTCAACTGG + Intronic
1150545928 17:66156667-66156689 ATTTATGTTCTTCTCTAAACTGG - Intronic
1150884751 17:69071880-69071902 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1153059239 18:978951-978973 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1153702772 18:7712654-7712676 ATTTATGTTCTTCTCTAAACTGG - Intronic
1153717710 18:7868052-7868074 ATTTATGTTCTTCTCTAAACTGG + Intronic
1154532171 18:15357714-15357736 TTTTTTCTTATCACCTTAACTGG - Intergenic
1155364655 18:25037695-25037717 ATTTATTTTCTCTCTTTAATGGG + Intergenic
1155395375 18:25380736-25380758 ATTTATTTTCTTCTCTAAACTGG - Intergenic
1155665046 18:28298375-28298397 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1155853242 18:30798646-30798668 CTTTGTCTTCTCCCTTTCACAGG + Intergenic
1155857198 18:30849123-30849145 ATTTATTTTCTTCTCTAAACTGG + Intergenic
1156188235 18:34688999-34689021 ATTTATGTTCTTCTCTAAACTGG + Intronic
1156304992 18:35869925-35869947 CTTTAACTTCTCCCCTGAAAGGG + Intergenic
1156979136 18:43264657-43264679 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1157067160 18:44365842-44365864 ATTTATGTTCTTCTCTAAACAGG + Intergenic
1157104580 18:44761823-44761845 CTTGATTTTCTCCCCTTAGCAGG - Intronic
1157694968 18:49715339-49715361 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1158073143 18:53496766-53496788 ATTTATGTTCTTCTCTAAACTGG - Intronic
1158098770 18:53805458-53805480 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1158105506 18:53881675-53881697 ATTTATATTCCCCTCTAAACTGG + Intergenic
1158297536 18:56015408-56015430 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1158398899 18:57103309-57103331 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1158606612 18:58901625-58901647 ATTTGTCTTCTCTCCCTCACTGG - Intronic
1158659200 18:59370870-59370892 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1158659203 18:59370918-59370940 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1159211113 18:65323230-65323252 TTTTATCTTCTCACTTTAAAAGG - Intergenic
1159569498 18:70096153-70096175 ATTTATGTTCTTCTCTAAACTGG + Intronic
1159661094 18:71096978-71097000 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1160466516 18:79082259-79082281 ATTTATGTTCTTCTCTAAACTGG + Intronic
1160642208 19:148072-148094 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1162231996 19:9274724-9274746 ATTTATCTGCTCCCTTGAAAGGG - Intergenic
1163328176 19:16618692-16618714 ACTATTCTTCTCCCGTTAACAGG + Intronic
1164152242 19:22565212-22565234 ATTTATGTTCTTCTCTAAACAGG + Intergenic
1164197143 19:22979148-22979170 ATTTATGTTCTTCTCTAAACTGG - Intronic
1165254457 19:34567069-34567091 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1165862999 19:38918813-38918835 ACTCATCCTCTCCCCTGAACAGG - Exonic
1166073410 19:40399394-40399416 ATTTATCTGTTCACCTTAATAGG + Intronic
1166972211 19:46576717-46576739 AATTACCTCCTTCCCTTAACAGG - Exonic
1167531040 19:50016799-50016821 ATTTCCCTTCTTCACTTAACTGG - Intronic
1168457846 19:56527611-56527633 ATTTATGTTCTTCTCTAAACTGG - Exonic
1202656113 1_KI270708v1_random:23574-23596 ATTTATGTTCTTCTCTAAACTGG - Intergenic
924967768 2:93578-93600 ATTTATGTTCTTCTCTAAACTGG - Intergenic
925217517 2:2110327-2110349 ATTTATCTGTTCCCCTTTATAGG + Intronic
925245170 2:2376283-2376305 ATTTATGTTCTTCTCTAAACTGG + Intergenic
925484363 2:4312219-4312241 ATTTATGTTCTCCTCTAAACTGG + Intergenic
925566239 2:5257542-5257564 ATTTATGTCCTTCCCTAAACTGG + Intergenic
925728964 2:6903672-6903694 ATTTATGTTCTTCTCTAAACTGG + Intergenic
926803543 2:16683798-16683820 AGATTTCTTCTCCCCTTCACAGG + Intergenic
927117324 2:19917529-19917551 ATTTATGTTCTTCTCTAAACTGG - Intronic
927182937 2:20459895-20459917 ATTTATATTCTTCTCTAAACTGG - Intergenic
927404806 2:22754831-22754853 ATTTTTTTTCTCTCCCTAACAGG + Intergenic
927554943 2:24024718-24024740 ACTCATCTTGTCCCCCTAACTGG + Intronic
928750801 2:34467795-34467817 ATTTATGTTCTTCTCTAAACTGG - Intergenic
928870220 2:35966975-35966997 TTTTGTCTTCTCCCTTCAACAGG + Intergenic
929064608 2:37961545-37961567 ATTTATGTTCTTCCCTAAACTGG + Intronic
929333384 2:40711778-40711800 ATTTATGTTCTTCTCTAAACTGG + Intergenic
929838166 2:45427168-45427190 ATTTATGTTCTTCTCTAAACTGG - Intronic
930175917 2:48301808-48301830 ATTTATATTCTTCTCTAAACTGG + Intergenic
930264584 2:49185349-49185371 ATTTATGTTCTTCTCTGAACTGG + Intergenic
930359466 2:50359393-50359415 ATTTATGTTCTTCTCTAAACTGG - Intronic
930476871 2:51892601-51892623 ATTTATGTTCTTCTCTTAACTGG - Intergenic
930552328 2:52851714-52851736 ATTTATGTTCTTCTCTAAACTGG + Intergenic
930860210 2:56064406-56064428 ATTTATGTTCTTCTCTAAACTGG + Intergenic
931004237 2:57829236-57829258 ATTTATGTTCTTCTCTAAACTGG - Intergenic
931074105 2:58689779-58689801 ATTTATATTCTTCTCTAAACTGG - Intergenic
931362783 2:61592330-61592352 ATTTATGTTCTTCTCTAAACTGG - Intergenic
931480538 2:62634557-62634579 ATTTATGTTCTTCTCTAAACTGG - Intergenic
931538806 2:63305839-63305861 ATTTATGTTCTTCTCTAAACTGG - Intronic
931556123 2:63507719-63507741 ATTTATGTTCTTCTCTAAACTGG - Intronic
931566585 2:63621311-63621333 ATTTATGTTCTTCTCTAAACTGG - Intronic
931814978 2:65891242-65891264 ATTTATGTTCTTCTCTAAACTGG - Intergenic
931886570 2:66624843-66624865 ATTTATGTTCTTCTCTAAACTGG + Intergenic
931907460 2:66858111-66858133 ATTTATTTTCTTCTCTAAACTGG + Intergenic
932051437 2:68402591-68402613 ATTTATGTTCTTCTCTAAACTGG + Intergenic
932067633 2:68583288-68583310 ATTTATCTTCTCCCCTTAACAGG + Intronic
932077070 2:68674426-68674448 ATTCCTCTTCTCCTCTTAACTGG - Intergenic
932511655 2:72299341-72299363 ATTTATGTTCTTCTCTAAACTGG + Intronic
933488140 2:82949430-82949452 ATTTATGTTCTTCCCTAAACTGG + Intergenic
933634809 2:84697131-84697153 ATATATCTTTTCCCCTTAGTTGG - Intronic
933711447 2:85328844-85328866 ATTTATTTTCTCCCCATATTGGG + Intergenic
934070000 2:88374948-88374970 ATTTATCTTCTCCTCCTACTTGG - Intergenic
934138481 2:89020618-89020640 ATTTCCCTTCTGCCCTTACCAGG + Intergenic
934230763 2:90179935-90179957 ATTTCCCTTCTGCCCTTACCAGG - Intergenic
934780570 2:96967142-96967164 ATTTTTCATCTTCCCCTAACTGG - Intronic
935010805 2:99134435-99134457 ATTTATGTTCTTCTCTAAACTGG + Intronic
935982977 2:108644784-108644806 ATTTATGTTCTTCTCTAAACTGG - Intronic
936617181 2:114060181-114060203 ATTTACCTTCCCCAGTTAACAGG + Intergenic
936640135 2:114303170-114303192 ATTTATGTTCTTCTCTAAACTGG + Intergenic
936667566 2:114614204-114614226 ATTTATCTACTCCACATCACCGG + Intronic
937143283 2:119619875-119619897 ATTTATGTTCTTCTCTAAACTGG - Intronic
937562845 2:123246017-123246039 ATTTATGTTCTTCTCTAAACTGG - Intergenic
937573655 2:123392963-123392985 ATTTATGTTCTGCTCTAAACTGG - Intergenic
938221292 2:129570123-129570145 ATTTATGTTCTTCTCTAAACTGG - Intergenic
938531270 2:132188941-132188963 TTTTTTCTTATCACCTTAACTGG - Intronic
938874281 2:135517128-135517150 ATTTATGTTCTTCTCTAAACTGG + Intronic
939033409 2:137102672-137102694 ATTTATATTCTTCTCTAAACTGG - Intronic
939180531 2:138797226-138797248 ATTTATGTTCTTCCCTAAACTGG - Intergenic
939247969 2:139649416-139649438 ATTTATATTCTTCTCTAAACAGG - Intergenic
939381895 2:141447268-141447290 ATTTATGTTCTTCTCTAAACTGG + Intronic
939640704 2:144637526-144637548 ATTTATGTTCTTCTCTAAACTGG + Intergenic
939652954 2:144786557-144786579 ATTTATGTTCTTCTCTAAACTGG - Intergenic
939678669 2:145104092-145104114 ATTTCTCTTCTCCCCTCCACCGG + Intergenic
939976059 2:148719095-148719117 ATTTATCTTCCTCTCTAAACTGG + Intronic
940054405 2:149499071-149499093 ATTTATGTTCTTCTCTAAACTGG + Intergenic
940084131 2:149838969-149838991 ATTTATGTTCTTCTCTAAACTGG + Intergenic
940114555 2:150193459-150193481 ATTTATCTTCTTCTCTAAACTGG - Intergenic
940407951 2:153327649-153327671 ATTTATATTCTTCTCTAAACTGG + Intergenic
940821543 2:158360959-158360981 ATTTATGTTCTTCTCTAAACTGG - Intronic
941076540 2:161011578-161011600 ATTTATGTTCTTCTCTAAACTGG - Intergenic
941478185 2:165973050-165973072 ATTTATGTTCTTCTCTAAACCGG - Intergenic
941682188 2:168411899-168411921 ATTTATGTTCTTCTCTAAACTGG + Intergenic
941845446 2:170127191-170127213 ATTTATGTTCTTCTCTAAACTGG - Intergenic
942200049 2:173561203-173561225 ATTTATGTTCTTCTCTAAACTGG - Intergenic
942431153 2:175913153-175913175 ATTTATATTCTTCTCTAAACTGG + Intergenic
942732727 2:179077193-179077215 ATTTATGTTCTTCTCTAAACTGG - Intergenic
943047489 2:182875756-182875778 ATTTATTTTCTTCTCTAAACTGG - Intergenic
943084855 2:183299655-183299677 ATTTATGTTCTTCTCTAAACTGG + Intergenic
943095024 2:183417906-183417928 ATTTATGTTCTTCTCTAAACTGG - Intergenic
943105885 2:183544872-183544894 ATTTATGTTCTTCTCTCAACTGG - Intergenic
943112206 2:183620806-183620828 ATTTATGTTCTTCTCTAAACGGG + Intergenic
943408621 2:187518999-187519021 ATTTATGTTCTTCTCTAAACTGG + Intronic
943409937 2:187533851-187533873 ATTTATGTTCTTTCCTAAACTGG - Intronic
943474708 2:188340341-188340363 ATTTTTCTTGACCCCTTCACAGG + Intronic
943599005 2:189892088-189892110 ATTTATGTTCTTCTCTAAACTGG + Intronic
943630156 2:190242276-190242298 ATTTATGTTCTTCTCTAAACTGG + Intronic
943836973 2:192525762-192525784 ATTTATGTTCTTCTCTAAACTGG - Intergenic
943891732 2:193296092-193296114 ATTTATGTTCTGCTCTAAACTGG - Intergenic
944275261 2:197830306-197830328 ATTTATGTTCTTCTCTAAACTGG - Intronic
944421718 2:199537637-199537659 ATTTATATTCTTCCCTGAACTGG - Intergenic
944608077 2:201370916-201370938 ATTTATGTTCTTCTCTGAACTGG - Intergenic
944764501 2:202850423-202850445 ATTTATGTTCTTCTCTAAACTGG - Intronic
945467180 2:210182598-210182620 ATTTATGTTCTTCTCTAAACTGG - Intergenic
946553948 2:220833870-220833892 ATTCACCTTCTCCCCCTAGCTGG + Intergenic
946790077 2:223292465-223292487 ATTTATGTTCTTCTCTAAACTGG + Intergenic
946823687 2:223655348-223655370 ATCTCTGTTCTCCCCTTCACAGG + Intergenic
947225708 2:227838538-227838560 ATTTATGTTCTTCTCTAAACTGG + Intergenic
947681272 2:232036375-232036397 ATTTATGTTCTTCTCTAAACTGG + Intronic
1168921909 20:1545471-1545493 ATTTATGTTCTTCTCTAAACTGG + Intronic
1169606015 20:7319917-7319939 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1169759178 20:9072994-9073016 TGTTATCTTCTCCCCTTTCCTGG + Intronic
1170134063 20:13053674-13053696 ATTTATGTTCTTCTCTAAACTGG - Intronic
1170727188 20:18940707-18940729 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1171000996 20:21415121-21415143 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1171513258 20:25705556-25705578 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1173213334 20:41055360-41055382 ACATACCTTTTCCCCTTAACTGG - Intronic
1173404408 20:42752472-42752494 AGTTATCTCCTGCCCTGAACTGG + Intronic
1173751015 20:45477031-45477053 ATTTATGTTCTTCTCTAAACTGG + Intronic
1174602517 20:51736212-51736234 CTTTATCTTCTCCCCGTGATGGG - Intronic
1174990006 20:55499436-55499458 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1175041091 20:56051177-56051199 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1176076209 20:63249401-63249423 ATTTACCATCTGCCCTTTACAGG + Intronic
1176631468 21:9142833-9142855 ATTTATATTCTTCTCTAAACTGG + Intergenic
1176641831 21:9312024-9312046 ATTTATATTCTTCTCTAAACTGG - Intergenic
1176765192 21:13010481-13010503 TTTTTTCTTATCACCTTAACTGG + Intergenic
1177092127 21:16782202-16782224 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1177099306 21:16880100-16880122 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1177136520 21:17309924-17309946 ATTTATATTCTTCTCTAAACTGG - Intergenic
1177184042 21:17774600-17774622 ATTTATGTTCTTCTCTTAACTGG + Intergenic
1177332161 21:19678959-19678981 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1177763907 21:25434741-25434763 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1177816593 21:25984710-25984732 AGTCATCTTCTCATCTTAACTGG + Intronic
1178393706 21:32220765-32220787 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1178933659 21:36842082-36842104 GTTTATCTTCTACTATTAACGGG - Intronic
1179680183 21:43014454-43014476 ATTTTTCTCATCCTCTTAACAGG + Intronic
1180350845 22:11801376-11801398 ATTTATATTCTTCTCTAAACTGG - Intergenic
1180375122 22:12084774-12084796 ATTTATATTCTTCTCTAAACCGG - Intergenic
1180387362 22:12190694-12190716 ATTTATATTCTTCTCTAAACTGG + Intergenic
1180429767 22:15236940-15236962 TTTTTTCTTATCACCTTAACTGG + Intergenic
1180512379 22:16105279-16105301 TTTTTTCTTATCACCTTAACTGG + Intergenic
1180596371 22:16976304-16976326 ATTTATGTTCTTCTCTGAACTGG - Intronic
1180598453 22:16996093-16996115 ATTTATGTTCTTCTCTAAACTGG - Intronic
1183533737 22:38381769-38381791 ATTTATCTTCTCACTGTAGCAGG - Intronic
1184546391 22:45171867-45171889 ATTTATCTTATTTCCTCAACTGG - Intronic
1184882320 22:47316394-47316416 ATTTGTCTTCTCACCTCAACCGG - Intergenic
949155155 3:817776-817798 ATTTATGTTCTTCTCTAAACTGG - Intergenic
949175911 3:1062641-1062663 ATTTATGTTCTTCTCTAAACTGG + Intergenic
949222566 3:1653433-1653455 ATTTATGTTCTTCTCTAAACTGG + Intergenic
949423386 3:3890474-3890496 ATTTATGTTCTTCTCTAAACTGG + Intronic
949583505 3:5413804-5413826 ATTTATGTTCTTCTCTAAACTGG - Intergenic
949594448 3:5529831-5529853 ATTTATGTTCTTCTCTAAACTGG + Intergenic
951082578 3:18469222-18469244 ATTTATCTTCTCCCTGGAATTGG + Intergenic
951198036 3:19846233-19846255 ATTTATGTTCTTCTCTAAACTGG + Intergenic
951254352 3:20431974-20431996 ATTTATGTTCTTCTCTAAACTGG + Intergenic
951360951 3:21723437-21723459 ATTTATGTTCTTCTCTAAACTGG - Intronic
951503518 3:23416906-23416928 ATTTATGTTCTTCTCTAAACTGG + Intronic
951628971 3:24698323-24698345 ATTTATGTTCTTCTCTGAACTGG + Intergenic
952679289 3:36073139-36073161 ATTTATCTTCCTCTCTAAACTGG + Intergenic
952842454 3:37659535-37659557 ATTTATGTTCTTCTCTAAACTGG + Intronic
953074198 3:39552486-39552508 ATTTATTTTCTTCTCTAAACTGG - Intergenic
953264411 3:41371929-41371951 ATTTATGTTCTTCTCTAAACTGG - Intronic
953316011 3:41926634-41926656 ATTTATGTTCTTCTCTAAACTGG - Intronic
953433499 3:42858810-42858832 ATTTATATTCTTCTCTAAACTGG - Intronic
953482043 3:43260143-43260165 TTGAATCTTCTCCCCTTACCTGG + Intergenic
953555093 3:43939294-43939316 ATTTATGTTCTTCTCTAAACTGG + Intergenic
954508053 3:51096499-51096521 ATTTATGTTCTTCTCTAAACTGG + Intronic
954525099 3:51262704-51262726 ATTTATGTTCTTCTCTAAACTGG - Intronic
954531228 3:51321613-51321635 ATTTATGTTCTTCTCTAAACTGG - Intronic
955447953 3:59033485-59033507 ATTTATGTTCTTCTCTAAACTGG - Intronic
955657686 3:61262673-61262695 ATTTATGTTCTTCTCTAAACTGG + Intergenic
956207534 3:66770364-66770386 ATTTATGTTCTTCTCTAAACTGG + Intergenic
956220226 3:66894314-66894336 ATTTATGTTCTTCTCTAAACTGG - Intergenic
956243551 3:67155565-67155587 ATTTATTTTCTTCTCTAAACTGG - Intergenic
956355859 3:68391146-68391168 ATTTATGTTCTTCTCTAAACTGG - Intronic
957256475 3:77844229-77844251 ATTTATGTTCTCCTCTAAACTGG + Intergenic
957695859 3:83636998-83637020 ATTTATGTTCTTCTCTAAACTGG - Intergenic
957993109 3:87652723-87652745 ATTTATGTTCTTCTCTAAACTGG + Intergenic
958434376 3:94079783-94079805 ATTTATGTTCTTCTCTAAACTGG + Intronic
958655022 3:96989937-96989959 TATTGTCTTCTCCACTTAACTGG - Intronic
959278342 3:104305584-104305606 ATTTATGTTCTTCTCTAAACTGG - Intergenic
959423072 3:106151665-106151687 ATTTATGTTCTTCTCTAAACTGG + Intergenic
959428538 3:106223243-106223265 ATTTATGTTCTTCTCTAAACTGG + Intergenic
959609979 3:108282697-108282719 CTTTTTCTTTTCTCCTTAACAGG - Intergenic
959617772 3:108367492-108367514 ATTTATATTCTCCTCTAAACTGG - Intronic
959735120 3:109649178-109649200 ATTTATGTTCTTCTCTAAACTGG - Intergenic
959801134 3:110496314-110496336 ATTTATGTTCTTCTCTAAACTGG - Intergenic
960177430 3:114533276-114533298 ATTTATGTTCTTCTCTAAACTGG - Intronic
960278312 3:115752160-115752182 ATTTATGTTCTTCTCTAAACTGG - Intergenic
960377999 3:116927148-116927170 ATTTATGTTCTTCTCTAAACTGG + Intronic
960491487 3:118321467-118321489 ATTTATGTTCTTCTCTAAACTGG + Intergenic
960579976 3:119268473-119268495 ATTTATGTTCTTCTCTAAACTGG - Intergenic
960768790 3:121168475-121168497 ATTTATATTCTTCTCTAAACTGG - Intronic
960773015 3:121216047-121216069 ATTTATCTTCTTCTCTAAACTGG + Intronic
960776652 3:121263606-121263628 ATTTATCTTCTTCTCTAAACTGG - Intronic
961965352 3:130895572-130895594 TTTTTTCTTCTGCCTTTAACCGG + Intronic
961998099 3:131268125-131268147 ATTTATGTTCTTCTCTAAACTGG + Intronic
962064521 3:131964508-131964530 ATTTATGTTCTTCTCTAAACTGG - Intronic
962180956 3:133206154-133206176 ATTTATGTTCTTCTCTAAACTGG + Intronic
962666187 3:137655484-137655506 ATTTATGTTCTTCTCTAAACTGG - Intergenic
962765851 3:138561676-138561698 ATTTATGTTCTTCTCTAAACCGG - Intronic
962817574 3:139016173-139016195 ATTTTTCTTTTCCCCATAAATGG + Intronic
963013832 3:140802139-140802161 ATTTATGTTCTTCTCTAAACTGG + Intergenic
963481361 3:145878941-145878963 ATTTATGTTCTTCTCTAAACTGG + Intergenic
963532147 3:146484075-146484097 ATTTATCTTCCTCTCTAAACTGG - Intronic
963551251 3:146726756-146726778 ATTTATGTTCTGCTCTAAACTGG - Intergenic
963629157 3:147712015-147712037 ATTTATGTTCTTCTCTAAACTGG + Intergenic
963898818 3:150713432-150713454 ATTTATGTTCTTCTCTAAACCGG - Intergenic
963998420 3:151738851-151738873 ATTTATGTTCTTCTCTAAACTGG + Intronic
964010515 3:151886430-151886452 ATTTATGTTCTTCTCTAAACTGG - Intergenic
964251901 3:154727697-154727719 ATTTATCTTCTCCACTTAGCTGG - Intergenic
964262964 3:154860971-154860993 AATTATCATATCCCCTTAATTGG - Intergenic
964371226 3:156002937-156002959 ATTTATTTTCTTCTCTAAACTGG + Intergenic
964377887 3:156068017-156068039 ATTTATGTTCTTCTCTAAACTGG + Intronic
964543242 3:157803379-157803401 ATTTATGTTCTTCTCTAAACTGG + Intergenic
964566821 3:158065681-158065703 ATTTATGTTCTTCTCTAAACTGG - Intergenic
964713079 3:159692580-159692602 ATTTATGTTCTTCTCTAAACTGG + Intronic
964904980 3:161708353-161708375 ATTTATGTTCTTCTCTAAACTGG - Intergenic
965090935 3:164162271-164162293 ATTTATGTTCTTCTCTAAACTGG + Intergenic
965618589 3:170620506-170620528 ATTTATGTTCTTCTCTAAACTGG + Intronic
965880604 3:173383441-173383463 ATTTATGTTCTTCTCTAAACTGG - Intergenic
966251219 3:177867005-177867027 ATTTATGTTCTTCTCTAAACTGG - Intergenic
966255285 3:177909758-177909780 ATTTATGTTCTTCTCTAAACTGG - Intergenic
966493866 3:180557592-180557614 ATTTATGTTCTTCTCTAAACTGG - Intergenic
966533160 3:181003359-181003381 ATTTATCTTCTTCTCTAAACTGG + Intergenic
966637772 3:182155558-182155580 ATTTATGTTCTTCTCTAAACTGG + Intergenic
967638752 3:191835737-191835759 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1202745063 3_GL000221v1_random:92994-93016 ATTTATATTCTTCTCTAAACTGG + Intergenic
970055207 4:11964229-11964251 ATTTATGTTCTCCTGTAAACTGG + Intergenic
970070991 4:12159994-12160016 ATTTATGTTCTTCTCTAAACTGG + Intergenic
970078900 4:12257070-12257092 ATGTATCATTTCCCCTTAATAGG + Intergenic
970727317 4:19061430-19061452 ATTTATGTTCTTCTCTAAACTGG - Intergenic
971004633 4:22358829-22358851 ATTTATGTTCTTCTCTAAACTGG - Intronic
971186590 4:24383511-24383533 ATTTATGTTCTTCTCTAAACTGG - Intergenic
971429915 4:26555366-26555388 ATTTATGTTCTTCTCTAAACTGG + Intergenic
971673472 4:29594534-29594556 ATTTATATTCTTCTCTAAACTGG + Intergenic
971679174 4:29674432-29674454 ATTTATGTTCTTCTCTAAACTGG - Intergenic
971883382 4:32410652-32410674 ATTTATGTTCTTCTCTAAACTGG - Intergenic
972255734 4:37353700-37353722 ATTTATGTTCTTCTCTAAACTGG + Intronic
972261181 4:37409294-37409316 ATTTATGTTCTTCTCTAAACTGG - Intronic
972500511 4:39673881-39673903 ATTTATGTTCTTCTCTAAACTGG + Intergenic
972742840 4:41905464-41905486 ATTTATGTTCTTCTCTAAACTGG + Intergenic
972755707 4:42043355-42043377 ATTTATGTTCTTCTCTAAACTGG - Intronic
972962889 4:44475000-44475022 ATTTATGTTCTTCTCTAAACTGG - Intergenic
973273147 4:48281203-48281225 ATTTATGTTCTTCTCTAAACTGG - Intergenic
973629242 4:52803276-52803298 ATTTATGTTCTTCTCTAAACTGG - Intergenic
973654446 4:53031570-53031592 ATTTATGTTCTTCTCTAAACTGG - Intronic
973679770 4:53304680-53304702 ATTTATGTTCTTCTCTAAACTGG + Intronic
973798536 4:54452469-54452491 ATTTATGTTCTTCTCTAAACTGG - Intergenic
974161898 4:58150815-58150837 ATTTATATTCTTCTCTAAACTGG - Intergenic
974306960 4:60155255-60155277 ATTTATGTTCTTCTCTAAACTGG + Intergenic
974336707 4:60556911-60556933 TTTTGTCTTTTTCCCTTAACAGG + Intergenic
974453162 4:62093194-62093216 ATTTATGTTCTTCTCTAAACTGG + Intergenic
974491486 4:62570796-62570818 ATTTATTTTCTTCTCTAAACTGG + Intergenic
974604630 4:64135501-64135523 ATTTTTCTACTCCCCTCAAAGGG - Intergenic
974639481 4:64609940-64609962 ATTATTTTTCTCACCTTAACAGG - Intergenic
974652692 4:64775766-64775788 AATTATCTTCTCTCCTTTATAGG - Intergenic
974811071 4:66946814-66946836 ATATATTTTCTCCACTCAACTGG + Intergenic
974985906 4:69025963-69025985 CTTGATCTTCTACCCTCAACTGG - Intronic
975178049 4:71309968-71309990 ATTTATGTTCTTCTCTAAACTGG - Intronic
975246015 4:72121035-72121057 ATTTATGTTCTTCTCTAAACTGG - Intronic
975367505 4:73545729-73545751 ATTTATCTTCTCCTCTAAACTGG - Intergenic
975433258 4:74320213-74320235 GTCTAACTTCTCCACTTAACAGG - Intergenic
975484042 4:74915022-74915044 ATTTATGTTCTTCTCTAAACTGG + Intergenic
975524384 4:75332591-75332613 ATTTATGTTCTTCTCTAAACTGG - Intergenic
975638932 4:76479264-76479286 ATTTATGTTCTTCTCTAAACTGG - Intronic
976065696 4:81184776-81184798 ATTTATGTTCTTCTCTAAACTGG - Intronic
976115004 4:81716516-81716538 ATTTATGTTCTTCTCTAAACTGG - Intronic
976363190 4:84203901-84203923 ATTTATGTTCTTCTCTGAACTGG - Intergenic
976370940 4:84287215-84287237 ATTTATATTCTTCTCTAAACTGG - Intergenic
976395054 4:84546239-84546261 ATTTATGTTCTTCTCTAAACTGG - Intergenic
976534197 4:86192628-86192650 ATTTATGTTCTTCTCTAAACTGG + Intronic
976655778 4:87487950-87487972 ATTTATGTTCTTCTCTAAACTGG + Intronic
976748178 4:88426880-88426902 ATCTATTTTCTCCCTTTACCAGG - Intronic
976852746 4:89567439-89567461 ATTTATGTTCTTCTCTAAACTGG + Intergenic
976903372 4:90207349-90207371 ATTTATGTTCTTCTCTAAACTGG + Intronic
977047034 4:92080273-92080295 ATTTATATTCTTCTCTAAACTGG - Intergenic
977140106 4:93360142-93360164 GTTTATTTTCTACTCTTAACTGG + Intronic
977154619 4:93556392-93556414 ATTTATGTTCTTCTCTAAACTGG - Intronic
977671535 4:99700359-99700381 ATTTATGTTCTTCTCTAAACTGG - Intergenic
977678722 4:99775182-99775204 ATTTATGTTCTTCTCTAAACTGG - Intergenic
977774560 4:100901716-100901738 ATTTATGTTCTTCTCTAAACTGG - Intergenic
977793071 4:101130035-101130057 ATTTATGTTCTTCTCTAAACTGG - Intronic
977897686 4:102383164-102383186 ATTTATGTTCTTCTCTAAACTGG + Intronic
977986327 4:103386668-103386690 ATTTATGTTCTTCTCTAAACTGG - Intergenic
978051227 4:104202701-104202723 ATTTATGTTCTTCTCTAAACTGG + Intergenic
978055054 4:104253228-104253250 ATTTATGTTCTTCTCTAAACTGG - Intergenic
978179398 4:105775209-105775231 ATTTATGTTCTTCTCTAAACTGG + Intronic
978185924 4:105857302-105857324 ATTTATGTTCTTCTCTAAACTGG + Intronic
978664434 4:111165322-111165344 ATTTATGTTCTTCTCTAAACTGG - Intergenic
978699624 4:111627308-111627330 ATTTATGTTCTTCTCTAAACTGG + Intergenic
978944848 4:114482796-114482818 ATATATTTTCTCCCATTTACAGG - Intergenic
979094307 4:116526314-116526336 AGTTCTCTTCTGCCCTTTACTGG - Intergenic
979512373 4:121568577-121568599 ATTTATGTTCTTCTCTAAACTGG - Intergenic
979554836 4:122033524-122033546 ATTTATGTTCTTCTCTAAACTGG + Intergenic
979668135 4:123335535-123335557 ATTTATGTTCTTCTCTAAACTGG + Intergenic
979705423 4:123714326-123714348 ATTTATGTTCTTCTCTAAACTGG - Intergenic
979819232 4:125150711-125150733 GTTTATGTTCTTCCCTAAACTGG + Intergenic
980200731 4:129652795-129652817 ATTTATGTCCTCCTCTAAACTGG - Intergenic
980330252 4:131402436-131402458 ACTTATCTTCTTCTCTAAACTGG + Intergenic
980583591 4:134786022-134786044 ATTTATGTTCTTCTCTAAACTGG + Intergenic
980633791 4:135472817-135472839 ATTTATGTTCTTCTCTAAACTGG + Intergenic
980861748 4:138507347-138507369 ATTTATGTTCTTCTCTAAACTGG + Intergenic
981126506 4:141113081-141113103 ATTTATGTTCTTCTCTAAACTGG + Intronic
981131711 4:141164089-141164111 ATTTATGTTCTTCTCTAAACTGG - Intronic
981133841 4:141188704-141188726 ATTTATGCTCTTCTCTTAACTGG + Intronic
981481324 4:145242351-145242373 ATTTATGTTCTTCTCTAAACTGG + Intergenic
981750005 4:148083807-148083829 ATTTATATTCTTCTCTAAACTGG - Intronic
981787833 4:148501746-148501768 ATTTATGTTCTTCTCTAAACTGG + Intergenic
981789500 4:148520759-148520781 ATTTATGTTCTTCTCTAAACTGG + Intergenic
981794811 4:148584457-148584479 ATTTATGTTCTTCTCTAAACTGG + Intergenic
981846658 4:149177129-149177151 ATTTATGTTCTTCTCTAAACTGG - Intergenic
981885484 4:149667715-149667737 ATTTATGTTCTTCTCTAAACTGG - Intergenic
981940098 4:150272599-150272621 ATTTATGTTCTTCTCTAAACTGG - Intronic
982298811 4:153858583-153858605 ATTTATGTTCTTCTCTAAACTGG + Intergenic
982794393 4:159628581-159628603 ATTTATGTTCTTCTCTAAACTGG + Intergenic
982852811 4:160341332-160341354 ATTTATCTTCTTCTCTAAACTGG + Intergenic
982897186 4:160946814-160946836 ATTTATCTTCTTTCTTTATCCGG + Intergenic
982909078 4:161117102-161117124 ATTTATGTTCTTCTCTAAACTGG + Intergenic
983047336 4:163003572-163003594 ATTTATGTTCTTCTCTAAACTGG + Intergenic
983543443 4:168936569-168936591 ATTTATGTTCTTCTCTAAACTGG - Intronic
983840996 4:172456486-172456508 ATTTATGTTCTTCTCTAAACTGG - Intronic
983949313 4:173621424-173621446 ATTTATGTTCTTCCTTAAACTGG + Intergenic
984354335 4:178638270-178638292 ATTTATATTCTTCTCTAAACTGG - Intergenic
984493812 4:180469673-180469695 ATTTATGTTCTTCTCTAAACTGG - Intergenic
984618787 4:181928315-181928337 ATTTATGTTCTTCTCTAAACTGG - Intergenic
984903102 4:184601967-184601989 ATTTATGTTCTTCTCTAAACTGG - Intergenic
985124064 4:186674092-186674114 ATTACTCTTCTCCCCTTATACGG + Intronic
985193875 4:187407284-187407306 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1202756716 4_GL000008v2_random:70221-70243 ATTTATATTCTTCTCTAAACCGG - Intergenic
985587266 5:746987-747009 ATTCATCATCTCTCCTTATCAGG - Intronic
985601816 5:839079-839101 ATTCATCATCTCTCCTTATCAGG - Intronic
986358681 5:6953397-6953419 ATTTATGTTCTTCTCTAAACTGG - Intergenic
986484484 5:8221299-8221321 ATTTATGTTCTTCTCTAAACTGG - Intergenic
986648084 5:9938047-9938069 ATTTATGGTCTCCTCTAAACTGG - Intergenic
986838686 5:11671633-11671655 ATTTATGTTCTTCTCTAAACTGG + Intronic
986920385 5:12673124-12673146 ATTTATGTTCTTCTCTAAACTGG + Intergenic
986996656 5:13614580-13614602 ATTTATTTTCCCCTCTAAACTGG - Intergenic
987528062 5:19079534-19079556 ATTTATGTTCTTCTCTAAACTGG + Intergenic
988289948 5:29271620-29271642 ATTTATATTCTTCTCTAAACTGG - Intergenic
988618363 5:32796293-32796315 ATTTATGTTCTTCTCTAAACTGG - Intergenic
988627883 5:32897732-32897754 ATTTATGTTCTTCTCTAAACTGG + Intergenic
988772440 5:34446663-34446685 ATTTATGTTCTCCTCTAAACTGG + Intergenic
988775114 5:34470371-34470393 ATTTATGTTCTTCTCTAAACTGG - Intergenic
988973830 5:36495593-36495615 AATTAGCTTGTCCCATTAACTGG - Intergenic
989029530 5:37104219-37104241 AGTTTTCTTCTTCCCTAAACTGG + Intergenic
989194309 5:38700920-38700942 ATTTATTTTCTTCTCTAAACTGG - Intergenic
989320572 5:40129906-40129928 ATTTATGTTCTTCTCTAAACTGG + Intergenic
989618907 5:43366019-43366041 ATTTATGTTCTTCTCTAAACTGG + Intergenic
989766156 5:45085815-45085837 ATTTATATTCTTCTCTAAACTGG - Intergenic
989825464 5:45849054-45849076 ATTTATGTTCTTCTCTAAACTGG - Intergenic
990099000 5:52157980-52158002 ATTTATGTTCTTCTCTAAACTGG - Intergenic
990163564 5:52970602-52970624 ATTTATGTTCTTCTCTAAACTGG + Intergenic
990803644 5:59633021-59633043 ATTTATGTTCTTCTCTAAACTGG - Intronic
991151607 5:63377103-63377125 ATTTATATTCTTCTCTAAACTGG - Intergenic
991161527 5:63508582-63508604 ATTTATGTTCTTCTCTAAACTGG - Intergenic
991417074 5:66404386-66404408 ATTTATGTTCTTCTCTAAACTGG + Intergenic
991532506 5:67631569-67631591 ATTTATATTCTTCTCTAAACTGG + Intergenic
992038733 5:72807892-72807914 ATTTATGTTCTTCTCTAAACTGG + Intergenic
992187460 5:74257825-74257847 ATTTATGTGTTTCCCTTAACTGG - Intergenic
992316830 5:75565236-75565258 ATTTATGTTCTTCTCTAAACTGG + Intronic
992505926 5:77387931-77387953 ATTTATGTTCTTCTCTAAACTGG + Intronic
992740480 5:79769151-79769173 ATTTATGTTCTTCTCTAAACTGG + Intronic
993119279 5:83754739-83754761 ATTTATGTTCTTCTCTAAACTGG - Intergenic
993165935 5:84355339-84355361 ATTTATGTTCTTCTCTAAACTGG + Intronic
993265618 5:85722592-85722614 ATTTATGTTCTTCTCTAAACTGG - Intergenic
993291854 5:86082463-86082485 ATTTATGTTCTTCTCTAAACTGG + Intergenic
993513284 5:88798495-88798517 ATTTATGTTCTTCTCTAAACTGG + Intronic
993609149 5:90032799-90032821 ATTTATGTTCTTCTCTAAACTGG - Intergenic
993674100 5:90796262-90796284 ATTTATGTTCTTCTCTAAACTGG - Intronic
993891827 5:93483735-93483757 ATTTATGTTCTTCTCTAAACTGG - Intergenic
993895124 5:93524141-93524163 ATTTATGTTCTTCTCTAAACTGG - Intergenic
993960830 5:94295276-94295298 ATTTATGTTCTTCTCTAAACTGG + Intronic
994005028 5:94827821-94827843 ATTTATGTTCTTCTCTAAACTGG + Intronic
994015178 5:94956552-94956574 ATTTATGTTCTTCTCTGAACTGG - Intronic
994233392 5:97335254-97335276 ATTTATGTTCTTCTCTAAACTGG + Intergenic
994344663 5:98669896-98669918 ATTTATCTTCCTCTCTAAACTGG - Intergenic
994378226 5:99038897-99038919 ATTTATGTTCTTCTCTAAACTGG - Intergenic
994437922 5:99762659-99762681 ATTTATGTTCTTCTCTAAACTGG + Intergenic
994450584 5:99936668-99936690 ATTTATCTGCTTCTCTTTACAGG - Intergenic
994609666 5:102019855-102019877 ATTTATGTTCTTCTCTCAACTGG - Intergenic
994715289 5:103314544-103314566 ATATATCTTCCCCCCTAAATTGG - Intergenic
994917902 5:106003729-106003751 GTTTATATTCTTCCCTAAACTGG + Intergenic
994991165 5:106999100-106999122 ATTTATGTTCTTCTCTAAACTGG + Intergenic
995211022 5:109539273-109539295 ATTTATATTCTTCTCTAAACTGG - Intergenic
995264504 5:110141793-110141815 ATTTCTCATTTCCCCTTAAAGGG + Intergenic
995283650 5:110362624-110362646 ATTTATCTTCTCTACTTGGCAGG + Intronic
995612505 5:113924895-113924917 ATTTATATTCTTCTCTAAACTGG - Intergenic
995815863 5:116167135-116167157 ATTTATGTTCTTCTCTAAACTGG - Intronic
996004455 5:118404389-118404411 ATTTATGTTCTTCTCTAAACTGG + Intergenic
996280593 5:121725544-121725566 ATTTATGTTCTTCTCTAAACTGG + Intergenic
996427774 5:123334191-123334213 ATTTATATTCTTCTCTAAACTGG + Intergenic
996829838 5:127727828-127727850 ATTTATTTTCTTCTCTAAACTGG - Intergenic
997069794 5:130608072-130608094 ATTTATGTTCTCCTCTAAACTGG - Intergenic
997546637 5:134713451-134713473 ATTTTTATTCTTCCCTTAATAGG + Intronic
997807400 5:136932585-136932607 ATTTATGTTCTTCTCTAAACTGG - Intergenic
998717860 5:144906367-144906389 ATTTATGTTCTTCTCTAAACTGG - Intergenic
998751954 5:145332623-145332645 ATTTATGTTCTTCTCTAAACTGG + Intergenic
998780001 5:145646389-145646411 ATTTATGTTCTTCCCTAAACTGG + Intronic
998934330 5:147217630-147217652 ATTTATGTTCTTCTCTAAACTGG - Intergenic
999029927 5:148280139-148280161 ATTTATGTTCTTCTCTCAACTGG + Intronic
999106286 5:149074108-149074130 ATTTATATTCTTCTCTAAACTGG - Intergenic
999138171 5:149337711-149337733 AATTATCTTCTTACATTAACAGG - Intronic
999488529 5:152025550-152025572 ATTTATATTCTTCTCTAAACTGG + Intergenic
999489696 5:152038193-152038215 ATTTATATTCTTCTCTAAACTGG + Intergenic
999556940 5:152753242-152753264 ATTTATCTTCCTCTCTAAACTGG - Intergenic
999602722 5:153284186-153284208 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1000194622 5:158946038-158946060 ATTTATGTTCTTCTCTAAACTGG + Intronic
1000375993 5:160582934-160582956 ATTTATGTTCTTCTCTAAACTGG + Intronic
1000523658 5:162328539-162328561 ATTTATGTTCTGCTCTAAACTGG - Intergenic
1001346252 5:170902377-170902399 ATTTATGTTCTTCTCTAAACTGG + Intronic
1002677310 5:180927616-180927638 ATTTATCTTCTTCTCTAAACTGG - Intronic
1002685935 5:181009320-181009342 ATTTATGTTCTCCTCTAAACTGG - Intergenic
1002734659 5:181376410-181376432 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1002890469 6:1327241-1327263 ATTTGTCTTCTCCCCATGCCGGG - Intergenic
1002996259 6:2287814-2287836 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1004593353 6:17074722-17074744 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1004929025 6:20443722-20443744 ATTTATCTTCACCCCTTTCAAGG + Intronic
1005120888 6:22388819-22388841 ATTTATGTTCCTCCCTAAACTGG + Intergenic
1005137431 6:22586018-22586040 ATTCAGCTTCTGCCCTTAACAGG + Intergenic
1005182735 6:23124906-23124928 ATTTATGTTCTTCCCTACACTGG + Intergenic
1005778227 6:29160882-29160904 ATTTATGTTCTCCTCTAAACTGG + Intergenic
1007612801 6:43161177-43161199 CTTCAACTTCTCCCCTTGACCGG + Intronic
1007858284 6:44880212-44880234 ATTTATATTCTTCTCTAAACTGG - Intronic
1008082784 6:47211036-47211058 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1008159388 6:48059006-48059028 ATTGACCTTCTGCCCTTATCCGG - Intronic
1008298613 6:49806781-49806803 ATTTATATTCCTCCCTAAACTGG - Intergenic
1008407457 6:51135287-51135309 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1008719286 6:54328757-54328779 ATTTATGTTCTTCTCTCAACTGG - Intronic
1008864126 6:56189253-56189275 ATTTATATTCTTCTCTAAACTGG - Intronic
1008997985 6:57680770-57680792 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1009186473 6:60580109-60580131 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1009236687 6:61132856-61132878 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1009240928 6:61184737-61184759 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1009264255 6:61533077-61533099 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1009305757 6:62088049-62088071 ATTTATGTTCTTCTCTAAACTGG + Intronic
1009458901 6:63888925-63888947 ATTTATGTTCTTCTCTAAACTGG - Intronic
1009492852 6:64313167-64313189 ATTTATGTTCTTCTCTAAACTGG - Intronic
1009512385 6:64569278-64569300 ATTTATGTTCTTCTCTAAACTGG - Intronic
1009529721 6:64796412-64796434 TTATATCCTCTCCCCTTAATGGG - Intronic
1009536815 6:64897740-64897762 ATTTATGTTCTTCTCTAAACTGG - Intronic
1009570320 6:65375663-65375685 ATTTATGTTCTTCTCTAAACTGG - Intronic
1009727722 6:67557213-67557235 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1009776931 6:68217481-68217503 ATTTATATTCTTCTCTAAACTGG + Intergenic
1009880646 6:69561749-69561771 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1010010502 6:71042618-71042640 ATGTATATTCTCTCCTTAATTGG + Intergenic
1010039000 6:71360172-71360194 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1010446868 6:75958730-75958752 ATTTATGTTCTTCTCTAAACTGG + Intronic
1010575063 6:77519710-77519732 ATTTATATTCTTCTCTAAACTGG - Intergenic
1010936732 6:81870882-81870904 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1010994154 6:82513551-82513573 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1011020555 6:82808347-82808369 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1011086628 6:83547754-83547776 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1011298807 6:85852736-85852758 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1011321236 6:86095553-86095575 ATTTATCTTCTTCTCTAAACTGG - Intergenic
1011340163 6:86305742-86305764 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1011466854 6:87667206-87667228 ATTTATCTTCTCAACAAAACAGG - Exonic
1012022576 6:93943625-93943647 TTTTATCTTCTCTTCTTCACAGG - Intergenic
1012024276 6:93968223-93968245 ATCAATCTTCTTCCCTTAAACGG - Intergenic
1012075165 6:94673517-94673539 ATTTATCTTCCCCTGTAAACTGG - Intergenic
1012082931 6:94784290-94784312 ATTTATGTTCCCCTCTAAACTGG + Intergenic
1012498049 6:99856416-99856438 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1013038135 6:106406163-106406185 ATTTATGTTCTTCTCTTAACTGG - Intergenic
1013200574 6:107891422-107891444 ATTTATGTTCTTCTCTAAACTGG + Intronic
1013216422 6:108031999-108032021 ATTTTTCTTGGCCCCTTCACTGG + Intergenic
1013682735 6:112542641-112542663 ATTTATATTCTTCTCTAAACTGG - Intergenic
1013901758 6:115165514-115165536 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1013920011 6:115393459-115393481 ATTTATGTTCTCCTCTAAACTGG + Intergenic
1013929865 6:115517377-115517399 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1014058355 6:117042940-117042962 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1014122959 6:117746885-117746907 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1014225160 6:118839280-118839302 ATTTATGTTCTTCTCTAAACTGG + Intronic
1014352524 6:120362641-120362663 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1014413265 6:121152857-121152879 ACTTATGTTCTTCTCTTAACTGG + Intronic
1014466474 6:121761781-121761803 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1014475341 6:121865192-121865214 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1014583586 6:123169021-123169043 ATTTCTCTTCTCACTTTTACTGG - Intergenic
1014589367 6:123244381-123244403 ATTTATGTTCTTCTCTAAACTGG - Intronic
1014836424 6:126166139-126166161 ATTTATTTTCTTCTCTAAACTGG + Intergenic
1014872480 6:126613907-126613929 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1014922572 6:127229777-127229799 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1015047039 6:128788319-128788341 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1015410713 6:132891062-132891084 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1015433076 6:133153918-133153940 ATTTATATTCTTCTCTAAACTGG + Intergenic
1015471995 6:133615867-133615889 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1015500908 6:133931976-133931998 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1015623245 6:135155192-135155214 ATTTATATTCTTCTCTAAACTGG + Intergenic
1015665890 6:135628271-135628293 AGATATCTTTTGCCCTTAACTGG - Intergenic
1016400066 6:143670699-143670721 ATTTATGTTCTTCTCTAAACTGG + Intronic
1016418245 6:143856290-143856312 ATTTATGTTCTTCTCTAAACTGG + Intronic
1016542311 6:145179232-145179254 ATTTATATTCTACTCTAAACTGG - Intergenic
1016591024 6:145743218-145743240 ATTTATATTCTTCTCTAAACTGG - Intergenic
1016691400 6:146942469-146942491 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1016717652 6:147252364-147252386 ATTTATGTTCTTCGCTAAACTGG - Intronic
1017197270 6:151715689-151715711 ATTTATGTTCTGCTCTAAACTGG + Intronic
1017347618 6:153403247-153403269 ATTTATCAACTACCCTTTACAGG + Intergenic
1017571559 6:155749879-155749901 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1017859108 6:158378792-158378814 ATTTATCTTCCCCTCAAAACTGG - Intronic
1017968554 6:159289408-159289430 ATTTATGTTCTTCTCTGAACAGG + Intergenic
1018094390 6:160372853-160372875 ATTTATGTTCTTCTCTAAACTGG + Intronic
1018110166 6:160529125-160529147 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1018507702 6:164489812-164489834 ATTTATCTTCTTCTCTAAACTGG + Intergenic
1019071762 6:169352726-169352748 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1019203524 6:170340346-170340368 ATTTATGTTCTTCTCTGAACTGG + Intronic
1019238913 6:170648730-170648752 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1020358131 7:7300169-7300191 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1020379059 7:7522281-7522303 ATTTATTTTCTCCTTTTAACTGG - Intronic
1020391259 7:7661170-7661192 ATTTATGTTCTTCTCTAAACTGG + Intronic
1020519443 7:9168209-9168231 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1020557864 7:9692238-9692260 ATTTATGTTCCTCTCTTAACTGG - Intergenic
1020640039 7:10743204-10743226 ATTTATGTTCTTCTCTTAGCTGG - Intergenic
1020716190 7:11676553-11676575 ATTTATGTTCTTCTCTAAACTGG - Intronic
1020884499 7:13804695-13804717 ATTTATATTCTTCTCTAAACTGG - Intergenic
1020935551 7:14459387-14459409 ATTTATGTTCTTCTCTAAACTGG - Intronic
1021166854 7:17353304-17353326 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1021390752 7:20089754-20089776 ATTTATGTTCCCCTCTAAACTGG - Intergenic
1021749205 7:23778688-23778710 ATTTATGTTCTTCTCTAAACAGG + Intronic
1021782164 7:24117187-24117209 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1021853419 7:24830675-24830697 ATTTATCTTCCACCTTTCACTGG - Intronic
1022615767 7:31928075-31928097 ATTTATGTTCTTCCCTAAACTGG - Intronic
1022884583 7:34629394-34629416 ATTTATATTCTTCCCTAAACCGG - Intergenic
1023511482 7:40958517-40958539 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1024017847 7:45334134-45334156 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1024664759 7:51535608-51535630 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1024731530 7:52258867-52258889 ATATATCTTCTCCCCATCCCAGG + Intergenic
1024998367 7:55293776-55293798 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1026488293 7:70839460-70839482 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1027441441 7:78223475-78223497 AGTTATCCTCTCCCCTAAATTGG - Intronic
1027449815 7:78318258-78318280 ATTTATGTTCTTCTCTAAACTGG - Intronic
1027466347 7:78519370-78519392 ATCTCTCATCTCCCCATAACAGG + Intronic
1027583022 7:80021411-80021433 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1027637226 7:80690288-80690310 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1027778065 7:82491599-82491621 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1027790540 7:82634668-82634690 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1027843491 7:83342911-83342933 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1027864422 7:83628639-83628661 ATTTATGTTCTTCTCTAAACTGG + Intronic
1027910599 7:84245446-84245468 ATTTATGTTCTTCTCTAAACTGG + Intronic
1028144445 7:87305639-87305661 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1028337465 7:89674818-89674840 ATTTATGTTCTTCTCTGAACTGG - Intergenic
1028523785 7:91760346-91760368 ATTTATGTTCTTCTCTAAACTGG - Intronic
1028630123 7:92925555-92925577 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1028766037 7:94560896-94560918 ATTTACCTTTTAGCCTTAACAGG - Intergenic
1028782764 7:94756488-94756510 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1028805906 7:95025930-95025952 ATTTATGTTCTTCTCTAAACTGG + Intronic
1028998231 7:97125689-97125711 ATTTATGTTCTTCTCTAAACTGG + Intronic
1029004593 7:97195131-97195153 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1029845107 7:103405038-103405060 ATTTATGTTCTTCTCTAAACTGG + Intronic
1029854991 7:103505875-103505897 ATTTATATTCTTCTCTAAACTGG - Intronic
1030140888 7:106303337-106303359 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1030325703 7:108216769-108216791 ATTTATGTTCTTCTCTAAACTGG + Intronic
1030428026 7:109405194-109405216 ATTTTTTTTTTCCCCTTAGCAGG - Intergenic
1030702930 7:112661413-112661435 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1031025517 7:116674946-116674968 ATACATTTTCTCCCCTTAAGAGG - Intronic
1031173192 7:118317175-118317197 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1031711148 7:125047585-125047607 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1031902566 7:127427612-127427634 ATTTATGTTCTTCTCTAAACTGG + Intronic
1032312438 7:130801384-130801406 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1032883313 7:136113691-136113713 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1033389446 7:140912608-140912630 ATTTCTCTGTTCCCCTTTACAGG + Intronic
1033619863 7:143052434-143052456 CTTTATCTTCTCGCCTTCATGGG + Exonic
1033679448 7:143579755-143579777 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1033692388 7:143749688-143749710 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1034097820 7:148425994-148426016 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1034314633 7:150118369-150118391 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1034365633 7:150543923-150543945 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1034792267 7:153982400-153982422 ATTTATGTTCTTCTCTAAACTGG + Intronic
1035508856 8:157879-157901 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1035696373 8:1600729-1600751 ATTTATGTTCTTCTCTAAACTGG + Intronic
1035794201 8:2338172-2338194 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1035798604 8:2383536-2383558 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1036401731 8:8414819-8414841 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1037589484 8:20301153-20301175 CTCTACCTTCTCCACTTAACTGG - Intronic
1037664675 8:20957524-20957546 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1037957286 8:23069401-23069423 CTTGATCTTCTCCCCTTCCCAGG + Intergenic
1038083163 8:24163386-24163408 ATTTATGTTCTTCTCTGAACTGG + Intergenic
1038403779 8:27306683-27306705 ATTTCTCTTCTTTCCTTATCAGG - Intronic
1039133996 8:34298858-34298880 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1039283115 8:36007696-36007718 ATTTATGTTCTTCCCTAAACTGG - Intergenic
1039284696 8:36027638-36027660 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1039935024 8:42035292-42035314 ATTTATCAACTTCCTTTAACCGG - Intronic
1040473714 8:47758958-47758980 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1040519958 8:48168217-48168239 ATTTATGTTCTTCTCTAAACGGG + Intergenic
1040614047 8:49017388-49017410 ATTTATCTTCCTCTCTAAACTGG + Intergenic
1040631748 8:49221611-49221633 ATTTATTATCACCCCTTAAAAGG - Intergenic
1040753041 8:50735407-50735429 ATTTGTGTTCTTCCCTAAACTGG - Intronic
1040942896 8:52851524-52851546 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1041155202 8:54978172-54978194 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1041418946 8:57645849-57645871 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1041423694 8:57696460-57696482 ATTTATGTTCTTCTCTGAACTGG - Intergenic
1041459591 8:58097399-58097421 ATTTATATTCTTCTCTAAACTGG + Intronic
1041471709 8:58217032-58217054 CTTTATCTTCTCCCTTCATCTGG - Intergenic
1041666446 8:60449348-60449370 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1041836768 8:62224710-62224732 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1041838192 8:62241093-62241115 ATTTATGTTCTCCTCTAAGCTGG + Intergenic
1041963574 8:63648445-63648467 ATCTATCTTATCTCCTCAACAGG + Intergenic
1042070670 8:64930287-64930309 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1042195731 8:66229802-66229824 ATTTATATTCTTCTCTAAACTGG - Intergenic
1042812766 8:72844794-72844816 ATTTATGTTCTTCTCTAAACTGG + Intronic
1042946321 8:74157794-74157816 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1042969171 8:74390036-74390058 ATTTATGTTCTTCTCTAAACTGG + Intronic
1043368134 8:79559516-79559538 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1044018233 8:87073155-87073177 AGTTATCTTCTTCTCTAAACTGG + Intronic
1044050965 8:87503379-87503401 ATTTATCTTCTTCCTGTTACAGG - Intronic
1044131242 8:88526478-88526500 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1044509322 8:93057355-93057377 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1044940107 8:97333999-97334021 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1044961148 8:97531465-97531487 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1045151641 8:99415269-99415291 ATTTATGTTCTTCTCTAAACTGG + Intronic
1045390731 8:101711555-101711577 ATTTATATTCTTCTCTAAACTGG - Intronic
1045619049 8:103952898-103952920 ATTTATGTTCTTCTCTAAACTGG - Intronic
1045783823 8:105898262-105898284 ATTTATATTCTTCTCTAAACTGG - Intergenic
1045839488 8:106562258-106562280 ATTTATATTCTTCTCTAAACGGG - Intronic
1045974954 8:108121885-108121907 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1045982534 8:108207911-108207933 ATTTATCTTGTGTCCTTAAGTGG - Intronic
1045982542 8:108207994-108208016 ATATATCTTCTGTCCTTAAGTGG - Intronic
1046017980 8:108629118-108629140 AATTATGTTCTCCTCTAAACTGG - Intronic
1046047832 8:108985418-108985440 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1046217707 8:111171426-111171448 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1046220069 8:111201949-111201971 ATTTATTTTCTTCTCTAAACGGG - Intergenic
1046984395 8:120371080-120371102 ATTGATATTCTCCCCTCACCTGG - Intronic
1047567788 8:126064507-126064529 ATTTATCTTCTGCACTAAGCTGG + Intergenic
1047690856 8:127353190-127353212 ATTTATCTTATTTCCTGAACTGG - Intergenic
1048913957 8:139164535-139164557 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1050031910 9:1394667-1394689 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1050201069 9:3146748-3146770 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1050237641 9:3598160-3598182 ATTTTTCTTGGCCCCTTCACCGG - Intergenic
1050239764 9:3623187-3623209 ATTTATTTTCTTCTCTAAACTGG + Intergenic
1050307871 9:4323721-4323743 ATCTGTCTTCTCCACTTGACTGG + Intronic
1050390137 9:5133981-5134003 ATTTATGTTCTTCTCTAAACTGG - Intronic
1050637550 9:7627770-7627792 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1050709568 9:8445679-8445701 ATTTTTTTTCTCCCCCTAAATGG - Intronic
1050913607 9:11104250-11104272 ATTTATCTTGTTCCATTTACAGG + Intergenic
1050963460 9:11766847-11766869 ATTTCTCTTCTTCTCTAAACTGG - Intergenic
1051045606 9:12869648-12869670 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1051230610 9:14951014-14951036 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1051354063 9:16224619-16224641 ATTTATGTTCTTCTCTAAACTGG - Intronic
1051571347 9:18562872-18562894 ATTTATGTTCTTCTCTAAACTGG + Intronic
1051611498 9:18966596-18966618 ATTTATATTCTTCTCTAAACTGG + Intronic
1051948116 9:22596947-22596969 ATTTATCTTCTCCCACTCAGTGG - Intergenic
1051998610 9:23249025-23249047 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1052018906 9:23502680-23502702 ATTTATTTTCTCCCATTGAATGG + Intergenic
1052052572 9:23865462-23865484 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1052061413 9:23965530-23965552 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1052096444 9:24390333-24390355 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1052329528 9:27252729-27252751 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1052366058 9:27613798-27613820 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1052382194 9:27784061-27784083 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1052561075 9:30084754-30084776 ATTCATATTCTCATCTTAACTGG + Intergenic
1052573592 9:30262936-30262958 ATTTCTTTTCTTCCATTAACTGG + Intergenic
1053595820 9:39560119-39560141 ATTTATCTTGTCCTCTTCAGAGG + Intergenic
1053616719 9:39774695-39774717 ATTTCTCTTCTTCTCTTAAAAGG + Intergenic
1053709878 9:40795442-40795464 TTTTTTCTTATCACCTTAACTGG - Intergenic
1053874884 9:42534012-42534034 ATTTCTCTTCTTCTCTTAAAAGG + Intergenic
1053897730 9:42760578-42760600 ATTTCTCTTCTTCTCTTAAAAGG - Intergenic
1054236798 9:62567688-62567710 ATTTCTCTTCTTCTCTTAAAAGG - Intergenic
1054267449 9:62932743-62932765 ATTTCTCTTCTTCTCTTAAAAGG - Intergenic
1054419782 9:64916236-64916258 TTTTTTCTTATCACCTTAACTGG - Intergenic
1054550935 9:66602196-66602218 ATTTCTCTTCTTCTCTTAAAAGG - Intergenic
1055239373 9:74164911-74164933 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1055344979 9:75326535-75326557 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1055386692 9:75770792-75770814 ATTTATCTTCTTCTCTAAACTGG + Intergenic
1055416785 9:76092147-76092169 ATGTATCTTTTGCCCTTAAGAGG - Intronic
1056176644 9:84042933-84042955 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1056385002 9:86089613-86089635 ATTTATGTTCTTCTCTAAACTGG + Intronic
1058029405 9:100178423-100178445 ATTTATGTTCTTCTCTAAACTGG - Intronic
1058259952 9:102815659-102815681 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1058492494 9:105516960-105516982 ATTTATATTCTTCTCTAAACTGG - Intronic
1058530228 9:105899270-105899292 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1058591166 9:106566426-106566448 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1058854217 9:109044395-109044417 ATTTATCTTCTTCCTTAGACAGG - Intronic
1059746077 9:117203191-117203213 ATTTATCTTCTTCTCTAAACTGG + Intronic
1059954735 9:119503464-119503486 ATTTATGTTCTTCCCTAAACTGG - Intronic
1060317615 9:122527178-122527200 ATGTATCTTGTCACCTTGACTGG - Exonic
1062759118 9:138329020-138329042 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1203688314 Un_GL000214v1:17280-17302 ATTTATATTCTTCTCTAAACTGG - Intergenic
1203754299 Un_GL000218v1:110438-110460 ATTTATATTCTTCTCTAAACTGG + Intergenic
1203713688 Un_KI270742v1:122944-122966 ATTTATATTCTTCTCTAAACTGG + Intergenic
1203537510 Un_KI270743v1:55077-55099 ATTTATATTCTTCTCTAAACCGG - Intergenic
1203647961 Un_KI270751v1:86773-86795 ATTTATATTCTTCTCTAAACTGG + Intergenic
1185861231 X:3581474-3581496 ATTTACCTTCTCCCCTTTCAAGG - Intergenic
1185982315 X:4793252-4793274 AGTTCTCTTATCCCCCTAACAGG - Intergenic
1186354362 X:8774229-8774251 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1186388003 X:9129651-9129673 ATTTTTATGCTCCCCCTAACAGG + Intronic
1186599654 X:11023650-11023672 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1186773173 X:12838209-12838231 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1186774712 X:12853638-12853660 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1186929278 X:14370474-14370496 ATTTATGTTTTCCTCTAAACTGG - Intergenic
1186960808 X:14735085-14735107 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1187728916 X:22233666-22233688 ATTTGTGTTCTCCTCTAAACTGG + Intronic
1187729677 X:22239525-22239547 ATTTATGTTCTCCTCTAAACTGG - Intronic
1188084281 X:25883624-25883646 ATTTATGTTCTTCTCTCAACTGG - Intergenic
1188921781 X:35986462-35986484 ATTTATGTTCTTCTCTAAACTGG + Intronic
1189039624 X:37529310-37529332 ATTTATTTTCTTCTCTAAACTGG + Intronic
1189754273 X:44254407-44254429 ATTTATGTTCTTCTCTAAACTGG - Intronic
1189871000 X:45382373-45382395 AAATATTTTCTCCCATTAACAGG + Intergenic
1189937909 X:46088410-46088432 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1190420244 X:50223118-50223140 ATTTATGTTCTTCTCTAAACTGG + Intronic
1190494941 X:51019923-51019945 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1190945995 X:55094763-55094785 ATTTATGTTCTTCTCTAAACTGG + Intronic
1191000972 X:55659302-55659324 ATTTATCTGCTGCCCTTCAAAGG - Intergenic
1191024408 X:55897659-55897681 ATTTATATTCTTCTCTAAACTGG - Intergenic
1191034505 X:56009745-56009767 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1191071893 X:56409874-56409896 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1191080996 X:56509219-56509241 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1191111883 X:56810605-56810627 ATTTATCTTCCTCTCTAAACTGG + Intergenic
1191113804 X:56831453-56831475 ATTTATATTCTTCTCTAAACTGG + Intergenic
1191206842 X:57843363-57843385 ATTTATGTTCTTCTCTGAACTGG - Intergenic
1191208240 X:57856273-57856295 ATTTATGTTCTTCTCTTAACTGG - Intergenic
1191222494 X:58004030-58004052 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1191238023 X:58151902-58151924 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1191591451 X:62889382-62889404 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1191686866 X:63900713-63900735 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1191725646 X:64278084-64278106 ATTTATGTTCTTCTCTAAACTGG + Intronic
1191785139 X:64908876-64908898 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1191787881 X:64936057-64936079 ATTTATGTTCTTCTCTAAACTGG - Intronic
1191788625 X:64944933-64944955 ATTTATGTTTTCCTCTAAACTGG + Intronic
1191795806 X:65019821-65019843 ATTTATGTTCTTCTCTAAACTGG - Intronic
1191802842 X:65100018-65100040 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1191824987 X:65354747-65354769 ATTTATTTTCTTCTCTAAACTGG - Intergenic
1191941983 X:66490478-66490500 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1192009397 X:67251483-67251505 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1192023745 X:67426215-67426237 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1192030846 X:67510490-67510512 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1192316546 X:70056242-70056264 TTATTTCTTCTCCCCTTCACAGG - Intergenic
1192598696 X:72438598-72438620 ATTTATGTTCTTCTCTAAACTGG - Intronic
1192662271 X:73053658-73053680 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1192692250 X:73375964-73375986 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1192712487 X:73606339-73606361 ATTCATCTTCTTCTCTAAACTGG + Intronic
1192741156 X:73893801-73893823 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1192755690 X:74045457-74045479 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1192883492 X:75313023-75313045 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1192931946 X:75815480-75815502 ATTTATGTTCTTCCATAAACTGG - Intergenic
1192933827 X:75838121-75838143 ATTTATATTCTTCTCTAAACTGG + Intergenic
1192964317 X:76160600-76160622 ATTTATATTCTTCTCTAAACTGG - Intergenic
1192966396 X:76182136-76182158 ATTTATGTTCTTCCCTAAACTGG + Intergenic
1193010777 X:76672323-76672345 ATTTATGTTCTTCTCTGAACTGG - Intergenic
1193040321 X:76997810-76997832 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1193060019 X:77196316-77196338 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1193065530 X:77255314-77255336 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1193068732 X:77284122-77284144 ATTTATCTTCTTCTCTAAACTGG - Intergenic
1193081443 X:77410889-77410911 ATTTATGTTCTCCTCTAAACTGG + Intergenic
1193145792 X:78074443-78074465 CTTTCTCTTGTCCCCTTAGCTGG + Intronic
1193330998 X:80235958-80235980 CCTTATCTTCTGCCCTTCACAGG - Intergenic
1193341170 X:80351504-80351526 ATTTATTTTCTTCTCTAAACTGG + Intronic
1193351904 X:80474012-80474034 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1193394387 X:80967350-80967372 ATTTATGTTCTTCTCTAAACAGG + Intergenic
1193404613 X:81085206-81085228 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1193409465 X:81144784-81144806 ATTTATGTTCTTCTCTAAACTGG - Intronic
1193434102 X:81450545-81450567 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1193685576 X:84572771-84572793 ATATATGTTCTTCTCTTAACTGG - Intergenic
1193897403 X:87129878-87129900 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1193909040 X:87279896-87279918 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1193949472 X:87779700-87779722 ATTTATTTTCTTCTCTAAACTGG - Intergenic
1194021400 X:88695814-88695836 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1194140001 X:90197245-90197267 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1194158666 X:90423717-90423739 ATTTATCTTCTTCTCTAAACTGG - Intergenic
1194242704 X:91471078-91471100 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1194545284 X:95226162-95226184 ATTTATGTTCTTCACTAAACTGG - Intergenic
1194576204 X:95617768-95617790 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1194624923 X:96215814-96215836 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1194782993 X:98048208-98048230 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1194954275 X:100161442-100161464 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1194958919 X:100213629-100213651 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1195140242 X:101951485-101951507 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1195232867 X:102869036-102869058 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1195519102 X:105811292-105811314 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1195624754 X:106996593-106996615 ATCTATCTTCTCCCCTAACCCGG + Intronic
1195833599 X:109088110-109088132 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1195842890 X:109193307-109193329 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1195844109 X:109208192-109208214 ATTTATATTCTACTCTAAACTGG + Intergenic
1195882290 X:109604676-109604698 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1195948338 X:110239334-110239356 ATTTATGTTCTTCTCTAAACTGG - Intronic
1196269657 X:113696766-113696788 ATTTATGTTCTTCTCTAAACCGG + Intergenic
1196273027 X:113734856-113734878 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1196492791 X:116288468-116288490 ATTTATCTTCTCAGCTCAGCAGG + Intergenic
1196587349 X:117444707-117444729 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1196631338 X:117943683-117943705 ATTTATGTTCTTCTCTAAACTGG + Intronic
1196946450 X:120831911-120831933 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1196998985 X:121416823-121416845 ATTTATCTTTTCCCCATATTGGG + Intergenic
1197051332 X:122062335-122062357 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1197157373 X:123284535-123284557 ATTTATGTTCTTCTCTAAACTGG - Intronic
1197191232 X:123649590-123649612 ATTTATGTTCTTCTCTTAACTGG - Intronic
1197349988 X:125371614-125371636 ATTTATCTTCTTCTCTAAACTGG + Intergenic
1197614155 X:128673864-128673886 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1197847187 X:130815033-130815055 ATTTATGTTCTTCTCTAAACTGG - Intronic
1197927053 X:131657461-131657483 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1198002130 X:132450520-132450542 ATTTATGTTCTTCTCTAAACTGG + Intronic
1198490083 X:137130722-137130744 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1198519145 X:137434654-137434676 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1198555947 X:137793323-137793345 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1198669580 X:139065027-139065049 ATTTATGTTCTTCTCTAAACTGG + Intronic
1198758163 X:140002189-140002211 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1199452072 X:147988862-147988884 ATTTATGTTCTTCTCTAAACTGG + Intronic
1199469675 X:148180897-148180919 ATTTATGTTCTTCTCTCAACTGG + Intergenic
1199524766 X:148780604-148780626 ATTTATGTTCTTCTCTAAACCGG + Intronic
1199752968 X:150838603-150838625 TTTTATTTTTTCCCCTTAAATGG - Intronic
1200388356 X:155917213-155917235 ATTTATGTTCTTCTCTAAACTGG + Intronic
1200407754 Y:2830555-2830577 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1200416915 Y:2921755-2921777 ATTTATGTTCTTCTCTAAACTGG + Intronic
1200485746 Y:3766213-3766235 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1200504981 Y:4000685-4000707 ATTTATCTTCTTCTCTAAACTGG - Intergenic
1200933385 Y:8717052-8717074 ATTTATCTGCTCCACTTTTCTGG - Intergenic
1201167930 Y:11228085-11228107 ATTTATATTCTTCTCTAAACTGG + Intergenic
1201312952 Y:12613303-12613325 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1201498110 Y:14612144-14612166 ATTTATATTCTTCTCTAAACTGG + Intronic
1201543320 Y:15132776-15132798 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1201563453 Y:15342720-15342742 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1201591354 Y:15618064-15618086 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1201633853 Y:16099883-16099905 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1201688666 Y:16736960-16736982 ATTTATCTTCTTCTCTAAACTGG + Intergenic
1201689869 Y:16751882-16751904 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1201707288 Y:16950874-16950896 ATTTATTTTCTTCTCTAAACTGG - Intergenic
1201854157 Y:18522267-18522289 ATATATGTTCTCCTCTAAACTGG - Intergenic
1201879164 Y:18798117-18798139 ATATATGTTCTCCTCTAAACTGG + Intronic
1201892434 Y:18957268-18957290 ATTTATATTCTCCTTTAAACTGG - Intergenic
1201922310 Y:19246525-19246547 ATTTATATTCTTCTCTAAACTGG - Intergenic
1201959308 Y:19661136-19661158 ATTTATGTTCTTCTCTAAACTGG - Intergenic
1201961798 Y:19689361-19689383 ATTTATGTTCTTCTCTAAACTGG + Intergenic
1202096159 Y:21250139-21250161 ATTTATATTCTTCTCTAAACTGG + Intergenic