ID: 932074249

View in Genome Browser
Species Human (GRCh38)
Location 2:68648128-68648150
Sequence TAGGGTGCCTCCTGTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932074249 Original CRISPR TAGGGTGCCTCCTGTGGAGT GGG Intronic
900522640 1:3113087-3113109 TGGGGGGCCTCTTGTGGAGGGGG + Intronic
905428219 1:37901212-37901234 TAGAGTGCCTGCTGTGCACTGGG - Intronic
906239427 1:44233311-44233333 CTGTGTGGCTCCTGTGGAGTAGG - Intronic
907729319 1:57050440-57050462 TAGGGTGCCTCCATGGGAGCAGG - Intronic
907743099 1:57185937-57185959 CAGAAAGCCTCCTGTGGAGTTGG + Intronic
909036829 1:70602935-70602957 TAGAGTGCCTTCTGTGGGCTGGG + Intergenic
911235122 1:95404176-95404198 TGGGGTGGCTTCTGTGGTGTTGG + Intergenic
914246807 1:145892349-145892371 TCAGCTCCCTCCTGTGGAGTGGG + Exonic
914746891 1:150507823-150507845 CAGGCTGCCTTCTGTGGAGAGGG - Intergenic
914984284 1:152442830-152442852 TAGGGTGCCTCCCATACAGTGGG + Intergenic
916363618 1:163998937-163998959 AAGGTTGCCTCCTGTGATGTGGG - Intergenic
917486088 1:175455851-175455873 TAGGGTGACTCCGTGGGAGTTGG - Intronic
919350625 1:196449212-196449234 TAGTGTGCCTACTGTGAAGGTGG - Intronic
919727590 1:200894190-200894212 CAGTGGACCTCCTGTGGAGTAGG + Intronic
919765516 1:201124817-201124839 CTCGGTCCCTCCTGTGGAGTGGG - Intronic
922536506 1:226384996-226385018 TGGGGAGCCTCCTTTGGAGCCGG - Intronic
924143842 1:241053412-241053434 TAGAGTTTCTCCTGTGGAGGGGG + Intronic
1066412171 10:35182709-35182731 TAGGCTGCTCCCTGGGGAGTAGG + Intronic
1067771412 10:49129223-49129245 TAGGGTGAGCCCTGTGAAGTAGG - Intergenic
1073277484 10:102325002-102325024 TAGAGTGCATACTGTGGAGAGGG - Intronic
1074150725 10:110757469-110757491 TTGGGTGCCTCCTCTGGATCAGG - Intronic
1078246825 11:9581052-9581074 TATGGTGACCTCTGTGGAGTGGG + Intronic
1081926047 11:46829711-46829733 TAGGGATCCCCCTGTGCAGTGGG - Intronic
1089875482 11:121717434-121717456 TTGGGTTCCTACTGTGAAGTTGG - Intergenic
1091789003 12:3260571-3260593 TACGGTGCCTCGCGTAGAGTAGG - Intronic
1092129055 12:6095843-6095865 ATGGGGGCCTCCTGGGGAGTGGG - Intronic
1092959677 12:13584145-13584167 CAGTGTGGCTCCTGAGGAGTGGG - Intronic
1096590535 12:52656016-52656038 TAGGGTCCCTGCTGTGCACTGGG - Intergenic
1096846530 12:54410215-54410237 AAGGATGCCTGCTGTGGAGCAGG + Intronic
1099246371 12:80197674-80197696 TAGAGTGCCTTTTGTGGAATCGG - Intergenic
1099743213 12:86668644-86668666 TAGAGTGCCTGCTCTGGAGCAGG + Intronic
1105506032 13:21010412-21010434 TAGGGTGGGGCCTGTAGAGTGGG - Intronic
1112319893 13:98396222-98396244 TAAGGTCCCTGCTGTGCAGTCGG + Intronic
1113493048 13:110706924-110706946 TAGGGTGCATACTGTGTATTGGG - Intronic
1113782075 13:112982533-112982555 TGGGGGGCCTCCTGCGGAGGAGG + Intronic
1115567071 14:34633940-34633962 TAGCATAACTCCTGTGGAGTAGG - Intergenic
1116801941 14:49452665-49452687 AAGGGCGGCTCCTGTGGACTAGG - Intergenic
1118883532 14:69848710-69848732 TAGGATTCCTCCAGTGGAGCTGG + Intergenic
1121096609 14:91221870-91221892 TGGGGTGCCTTCTGGGAAGTTGG - Intronic
1123971031 15:25507965-25507987 TTGGCTTCCTCCTGTGCAGTAGG + Intergenic
1127400684 15:58582378-58582400 TCGGGTGCTTCCTACGGAGTGGG + Intergenic
1127838598 15:62810544-62810566 TAGTGTGCCTAGTGTGGAGCTGG + Intronic
1129454080 15:75667257-75667279 TAGGGTGACTGCTGTGTAATTGG + Intergenic
1132550313 16:551309-551331 ATGGGTGCCTCCTGTGGCGGGGG + Exonic
1136547983 16:30966036-30966058 TAGGCTGCCTCCTGCGGGGGTGG - Exonic
1137977595 16:53044320-53044342 TAAGGAGCCCCCTGTGGGGTGGG + Intergenic
1139596036 16:67958859-67958881 AAGGTTGCCTCAGGTGGAGTTGG + Intronic
1142150752 16:88511575-88511597 TGGGGTGCCTCCTGAGGACTTGG - Intronic
1144859664 17:18292959-18292981 TAGGCTGCCTTCAGTTGAGTTGG - Intronic
1144888034 17:18477243-18477265 AAGGGTGCGTACTGTGGAGTTGG + Intronic
1145144173 17:20467060-20467082 AAGGGTGCGTACTGTGGAGTTGG - Intronic
1145175628 17:20698473-20698495 AAGGGTGCGTACTGTGGAGTTGG - Intergenic
1145209721 17:21004183-21004205 AAGGGTGCGTCCTGTGGGGTGGG - Exonic
1147167564 17:38601580-38601602 CAAGGTGCCTGCTGTGGTGTGGG + Intronic
1147678177 17:42221393-42221415 TCAGCTGCCTCCAGTGGAGTAGG - Intronic
1147687773 17:42297545-42297567 TCAGCTGCCTCCAGTGGAGTAGG + Intronic
1147712413 17:42478600-42478622 GAGATTGCATCCTGTGGAGTAGG + Intronic
1149032411 17:52099066-52099088 CAGGGTGGCTCCTATGGACTGGG + Intronic
1149268816 17:54955012-54955034 TAGGGTGCCTCCTCTGGCAATGG - Intronic
1150751758 17:67870368-67870390 TTGGGTGCCTCCTGTGGGCCAGG + Intronic
1151947222 17:77326232-77326254 TTGGGTGCTCCCTGTGGACTTGG + Intronic
1152436327 17:80278492-80278514 CAGGGTGCCGCCTCTGGTGTGGG + Intronic
1156422281 18:36967780-36967802 TTCAGTGACTCCTGTGGAGTGGG + Intronic
1163257569 19:16166455-16166477 TTGAGTGCCTACTGTGTAGTGGG + Intronic
1165154014 19:33776814-33776836 TAGGGTCCCTCCTGGGGCTTGGG + Intergenic
1165689929 19:37855402-37855424 TAGGAAGCCTGCTGTGGAGCAGG - Intergenic
1166365090 19:42274183-42274205 CAGGGTGCCTGCTGTGCAGCGGG + Intronic
926171496 2:10555720-10555742 TAGGGAGCCTCCCGTGGGGCAGG + Intergenic
926223030 2:10948715-10948737 TGGGGTGCCTGGTGTGGAGTTGG + Intergenic
930159039 2:48134430-48134452 TATTGTTCCTTCTGTGGAGTGGG + Intergenic
930723262 2:54658185-54658207 ATGGGTGGCTCCTGTGGAGCAGG + Intronic
930726092 2:54682888-54682910 TTGAGTGCCTGCTGTGGATTAGG - Intergenic
931717057 2:65037598-65037620 GAGGGTGCCAGCTGTGGAGATGG - Intergenic
932074249 2:68648128-68648150 TAGGGTGCCTCCTGTGGAGTGGG + Intronic
934952399 2:98586090-98586112 CAGGGGGCCTCCTGTGGCCTAGG + Intronic
936056254 2:109264286-109264308 TGGGGTGGATCCTGTGGAGGTGG - Intronic
936665706 2:114593119-114593141 TAGGCTGCCTCCAGTGGTTTGGG - Intronic
937332393 2:121039752-121039774 TGGTGTGCCTCCTCTGGAGAAGG - Intergenic
938072388 2:128315592-128315614 TGGGGTGCCTCATGTTAAGTGGG - Intronic
938832721 2:135069722-135069744 TAGAGAGCCTACTGTGCAGTAGG + Intronic
940404439 2:153284374-153284396 TGAGGTGCCTGCTCTGGAGTGGG - Intergenic
942003509 2:171674824-171674846 TAGAGTGCCTCCTATGTTGTGGG + Intergenic
1173897528 20:46562300-46562322 TGGGGTGGCTGCAGTGGAGTTGG - Intronic
1174094372 20:48076433-48076455 TAGGGTGCAGGCTGTGGATTGGG - Intergenic
1174095708 20:48087993-48088015 CAAGGTCCCCCCTGTGGAGTAGG - Intergenic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1175530723 20:59672855-59672877 CAGGGTGGCTCCTGTGGAGGTGG + Intronic
1179144419 21:38754709-38754731 GAGGGTGCCTACAGTGGAGTTGG - Intergenic
1179413497 21:41179741-41179763 GAGGGTGCCTGGTGTGGGGTGGG + Intronic
1179937458 21:44614378-44614400 GACGGTGCCTCTTGTGGAGCCGG - Intronic
1181333450 22:22112396-22112418 TATGATGCCTACAGTGGAGTAGG + Intergenic
1181430712 22:22880138-22880160 TACGGTGTCACCTGTAGAGTGGG + Intronic
1183603084 22:38851256-38851278 TAGGGAGCCTCGTGTGTGGTGGG - Intergenic
952667406 3:35922992-35923014 TGGAGTGCCTACTCTGGAGTTGG - Intergenic
956171661 3:66438058-66438080 TTGGGTGGCTGGTGTGGAGTGGG + Intronic
958705965 3:97655742-97655764 TGGGGGGCCTGTTGTGGAGTGGG + Intronic
959029083 3:101276902-101276924 TAGGGTGATTCTAGTGGAGTAGG - Intronic
963099124 3:141581662-141581684 TATGGTGCCTGATGTAGAGTGGG + Intronic
968547026 4:1204531-1204553 TAGGGAGCCCCGTGTGGAGCTGG - Intronic
969122050 4:4918095-4918117 TTGTTTGCCTCCTGTGGGGTGGG + Intergenic
971525914 4:27618487-27618509 TAGGGTGCCTCCTCCAGAGCAGG - Intergenic
973982851 4:56320791-56320813 TTGGGTGCCTCACGTGGAGGTGG + Intronic
975226744 4:71881301-71881323 TAGGGTGCTCCCTGTATAGTTGG + Intergenic
981935942 4:150240048-150240070 TACAGTGCCTCCTGTGAAGGTGG + Intronic
982667871 4:158289128-158289150 CACGGTGCCTTTTGTGGAGTGGG - Intergenic
984192310 4:176620261-176620283 TTGGGTGCCCCCTGGGGAGGAGG - Intergenic
991968697 5:72117554-72117576 TAGTATTGCTCCTGTGGAGTAGG + Intronic
994203246 5:97002597-97002619 TAGAGTGCCTACTATGTAGTGGG + Intronic
998584064 5:143407195-143407217 TTGGGTGCCTGCTATGTAGTGGG - Intronic
999647733 5:153735687-153735709 TGGGGTGACTGCTGTGGAGGTGG + Intronic
1003487946 6:6595772-6595794 TAGCATGCCTCCTGTGCAGGAGG - Intronic
1004244885 6:13964843-13964865 TTGGGTGCGTCCTTTGGAGCAGG + Intronic
1009936488 6:70240714-70240736 TAGGGTGCCTCTGGTGAAGAAGG - Exonic
1010731240 6:79393857-79393879 TAGGGTGCCAGCAGTGGAGATGG - Intergenic
1019102776 6:169645189-169645211 TAGTGTGACTCCTGTGAACTAGG - Intronic
1019102791 6:169645405-169645427 TAGTGTGACTCCTGTGAACTAGG - Intronic
1019359044 7:595374-595396 GAGGGTGATTCCTGTGGAGAAGG - Intronic
1020037501 7:4973800-4973822 GATGGTGGCTCCTGTGGGGTCGG + Intergenic
1023494252 7:40777773-40777795 TAAGTTGCCTCCTGTGAAGGAGG + Intronic
1025994220 7:66518168-66518190 CAGGGGGCCTCCCGTGGAGCTGG - Intergenic
1026033780 7:66816496-66816518 CAGGGGGCCTCCTGTGGAGCTGG + Intergenic
1029421973 7:100476601-100476623 GAGGGTGACCACTGTGGAGTGGG - Intronic
1031884600 7:127232732-127232754 TATGGTGCCTCCTATGGAGCAGG + Intronic
1036607205 8:10318061-10318083 TAGGGTACCTGCTGGGGAGGGGG - Intronic
1039204903 8:35141388-35141410 CAGGGTGACGGCTGTGGAGTAGG - Intergenic
1042255381 8:66797508-66797530 TAGGGTGTCTCATGTATAGTGGG + Intronic
1051832485 9:21295829-21295851 TAGTTTGCCTCCTTTGGAGATGG + Intergenic
1052825757 9:33173017-33173039 TAGGAAGTCTCCTGTGAAGTAGG + Intergenic
1055749075 9:79484777-79484799 TAGGATGAGTACTGTGGAGTTGG - Intergenic
1056838662 9:89979779-89979801 TAGGGTGCATTCCTTGGAGTGGG + Intergenic
1058658477 9:107247103-107247125 TTGGGTGTCTCATGTGGAGGGGG - Intergenic
1059288850 9:113203434-113203456 GAGGGAGCTTCCTGTGGTGTGGG - Intronic
1059632060 9:116135397-116135419 GAGGGTGCTTGCTGTAGAGTAGG + Intergenic
1061260969 9:129480968-129480990 CAGGGTGCTGCCTGTGGGGTGGG + Intergenic
1062184636 9:135211474-135211496 AGGGGGGGCTCCTGTGGAGTGGG - Intergenic
1185768191 X:2743410-2743432 TAGGATGCCACCTGTGGTGCAGG - Intergenic
1186291934 X:8109816-8109838 TAGGCTGCCTGCTGCAGAGTGGG + Intergenic
1186436576 X:9547874-9547896 GAGGAAGCATCCTGTGGAGTTGG - Intronic
1189495702 X:41506310-41506332 TAGGCTGCCTCTTCTGGAGTGGG + Intergenic
1190531751 X:51385888-51385910 TAAGGTGGCTCCTGTGGTCTTGG + Intergenic
1192492230 X:71586213-71586235 TAGGGTGCTACTAGTGGAGTTGG + Intronic
1194553728 X:95332497-95332519 TAGGGGGCTGCCAGTGGAGTTGG + Intergenic
1199677196 X:150198688-150198710 TCAGGTGCCTCCTGTGTAGCAGG + Intergenic
1200788492 Y:7279429-7279451 AAGGGTGCCTCCTGTGTGGCTGG + Intergenic