ID: 932074809

View in Genome Browser
Species Human (GRCh38)
Location 2:68653089-68653111
Sequence CTCCATTTTCATTGTGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932074808_932074809 2 Left 932074808 2:68653064-68653086 CCAGTGAGAGCAGAATGTCTTAA 0: 1
1: 0
2: 0
3: 14
4: 155
Right 932074809 2:68653089-68653111 CTCCATTTTCATTGTGAGTCAGG 0: 1
1: 0
2: 0
3: 36
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932074809 Original CRISPR CTCCATTTTCATTGTGAGTC AGG Intronic
903253594 1:22075145-22075167 CTCCGTTTTGATTTTTAGTCTGG + Intronic
904417407 1:30371795-30371817 TTCCACTTTCAATGTGGGTCAGG - Intergenic
905049047 1:35033166-35033188 CTCCATTTTGATTTTTAGTCTGG + Intergenic
908648881 1:66310390-66310412 CTCCATTTGCATTGAGAGAGTGG - Intronic
908817371 1:68047996-68048018 CTCCACTGTCATTGTGACTAAGG - Intronic
910106530 1:83636997-83637019 CTGCATTTTCATTGTGTCTTAGG - Intergenic
910158070 1:84242874-84242896 CACCATTTCCATTCTGCGTCTGG - Intergenic
912324483 1:108744940-108744962 CTCCCTTTTCATTTTAAGTTAGG - Intergenic
914964327 1:152240627-152240649 GTCAATATTCATTGTCAGTCTGG - Intergenic
915015681 1:152731001-152731023 CTTGATTTTCATTTTGAGACAGG - Intergenic
915258635 1:154657526-154657548 CTACATGTTCATCATGAGTCAGG + Intergenic
916402908 1:164468350-164468372 CTCTATTTTATTTGTTAGTCTGG - Intergenic
916877235 1:168982409-168982431 CTCCATTTTGATTTTTAGTATGG - Intergenic
916957363 1:169852911-169852933 CTCCATTTCCATTGAAAGCCAGG - Exonic
918965788 1:191345765-191345787 ATGCATTTTCATTTTGATTCAGG - Intergenic
920432877 1:205929882-205929904 GTCCATCGTCTTTGTGAGTCTGG - Exonic
920541819 1:206784557-206784579 TTGCAGTTTCGTTGTGAGTCAGG + Intergenic
920734852 1:208524016-208524038 CTGCATCTTCAGAGTGAGTCAGG - Intergenic
921898537 1:220425980-220426002 CTCAATTTTCACTTTTAGTCTGG - Intergenic
922047688 1:221962602-221962624 CTCCATTTTGATTTTTAGTCTGG + Intergenic
922546139 1:226458374-226458396 CTCTATTTTGATTTTTAGTCTGG + Intergenic
924258460 1:242205648-242205670 CTCCATTTTCATTTTGGTTCTGG + Intronic
1065066567 10:21973312-21973334 GGCCATTTTCATTGTTAGTGTGG - Intronic
1065613328 10:27494888-27494910 CTCCATTTTGATTTTTAGTTTGG + Intergenic
1067282782 10:44885574-44885596 CTCCATTTTGATTTTTAGTCTGG + Intergenic
1069020663 10:63484814-63484836 CTCTATTTTCTATTTGAGTCTGG - Intergenic
1070204785 10:74246729-74246751 CTCCATTTTGATTTTTAGTCTGG + Intronic
1073249267 10:102111843-102111865 CTCCTTTTTCTTTTTGAGACAGG - Intronic
1073836734 10:107452938-107452960 CTGCATTTTCAATGGGATTCAGG - Intergenic
1075794132 10:125106867-125106889 CTCCATTCTCCTGGTGAGTCTGG - Intronic
1076269423 10:129138093-129138115 CTCCATTTTTATTGTTTGTGAGG + Intergenic
1077022711 11:426194-426216 CGCCATTTTAATTGTGACTTGGG - Intronic
1077300896 11:1846449-1846471 CTCCATGTTCATTGTACATCTGG - Intergenic
1078825151 11:14922872-14922894 CTTCATTTTCAATCTGTGTCTGG + Intronic
1079285031 11:19121222-19121244 GTGCATTTTCATTGCTAGTCAGG + Intronic
1080634104 11:34108255-34108277 CTCCATTCTCAATGAGAATCCGG - Exonic
1082912559 11:58393196-58393218 CTCTATTTTCTTTGTGCCTCAGG - Intergenic
1083884842 11:65567829-65567851 CCCCATTTTTATTTTGAGTCAGG + Intergenic
1085253206 11:75157083-75157105 CTCCATCTTCATCTTGAGTAGGG - Intronic
1086081599 11:82908604-82908626 CTCTATTTTGATTTTTAGTCTGG - Intronic
1087846472 11:102979183-102979205 CTCTCTTTTCATTATTAGTCTGG + Intergenic
1089809597 11:121120934-121120956 CTTCGTTTTCTTTGTGAGACAGG + Intronic
1091093078 11:132791626-132791648 CTCCATGTTCACTTTGAGGCAGG - Intronic
1092721497 12:11445747-11445769 CACCATTTTGATTTTTAGTCTGG + Intronic
1095577123 12:43753239-43753261 TTCGAATATCATTGTGAGTCAGG + Intronic
1098531449 12:71546396-71546418 CTCCATGTTCACTGTGAATGCGG - Intronic
1100737772 12:97556530-97556552 CTCCATGTTGACTGTGATTCTGG + Intergenic
1101099228 12:101375253-101375275 CCCCATTTTTTTTTTGAGTCAGG - Intronic
1103382608 12:120506227-120506249 CTCCATCTTGATTCTTAGTCTGG - Intronic
1110851428 13:80249614-80249636 TTCAATTTTCATTGTGAGGTAGG - Intergenic
1111539500 13:89651963-89651985 CTTCATTTTCATTTTGATACTGG - Intergenic
1113514696 13:110885180-110885202 CTCCACTTTCACTATGACTCAGG + Intronic
1118385883 14:65255257-65255279 CTCCATTCTCAGAGTGAGACAGG + Intergenic
1118807876 14:69253487-69253509 CTCCATTTTCCTTGTGAAACTGG - Intergenic
1119114925 14:72010641-72010663 CTCCATTTTGATTTTCAATCTGG - Intronic
1120223378 14:81761173-81761195 AACCATTTTCTTTGTGAGTAGGG - Intergenic
1121760945 14:96444487-96444509 CTCCATTTTGATTTTCAGTCTGG - Intronic
1122748211 14:103912987-103913009 CTACAGTTTCATTGTCACTCTGG + Intronic
1123829694 15:24121908-24121930 TTACATTTTCAGTGTGAGGCAGG + Intergenic
1124379559 15:29153810-29153832 CTCCATTTTTGTTCTGAGACAGG + Intronic
1124602450 15:31146425-31146447 CTCCATTTTGATTTCTAGTCTGG - Intronic
1124924534 15:34058384-34058406 CTCCATTTTGATTTTTATTCTGG - Intronic
1127096722 15:55518508-55518530 CTCCATTTTCATTTAGCATCAGG - Intergenic
1131162410 15:90116023-90116045 CTCCATTTTGATTTTCAGTCTGG + Intergenic
1131541948 15:93281838-93281860 CTCCATTTTGAGTGAGAGCCAGG - Intergenic
1133516726 16:6516732-6516754 CTCCATTCTCATTGTGGTTTGGG + Intronic
1135249217 16:20886485-20886507 CTCCATTTTGATTTTTAGTCTGG - Intronic
1135251261 16:20902128-20902150 CTCCATTTCCACTGTGACTGAGG - Intronic
1136780325 16:32896258-32896280 ATCAATTTTCATTGTGACCCAGG + Intergenic
1138557547 16:57781307-57781329 CTCCTTTTTTATTTTGAGGCAGG - Intronic
1141237414 16:82231345-82231367 CTCCATTTTCATTTTTATCCAGG - Intergenic
1141707742 16:85677682-85677704 GTCCATTTTTATTGTGGATCAGG + Exonic
1142538091 17:634151-634173 CTCCATATTCTTGGTGACTCTGG + Intronic
1144539877 17:16130687-16130709 TTTTATTTTCATTGTGAGACAGG + Intronic
1145021696 17:19436605-19436627 CTCTATTTTGATTTTTAGTCTGG - Intergenic
1146103054 17:30004507-30004529 CTCCATTTTGATTTTTAGTCTGG + Intronic
1146291757 17:31612783-31612805 CTCCAATTCCTTTGTGAGCCTGG - Intergenic
1147019478 17:37520126-37520148 CTCCATTTTAATTTTGAGTGTGG - Intronic
1148317557 17:46716562-46716584 CTCCATTTTTAGTGTGAGGATGG + Intronic
1148817534 17:50340742-50340764 ATCCATTTTGATTTTTAGTCTGG - Intergenic
1148817582 17:50341285-50341307 CTCCATTTTGATTTTTAGTCTGG + Intergenic
1150465711 17:65391063-65391085 CTCCCTTTTCTTTTTGAGACAGG - Intergenic
1150719396 17:67601747-67601769 CTCCTTTTTCTTTTTGAGACAGG - Intronic
1151780443 17:76241416-76241438 TTCTATTTTCTTTGTGGGTCTGG + Intergenic
1153240590 18:3028129-3028151 CTCCATTTTAATTTTTAGTCTGG + Intergenic
1153476378 18:5502969-5502991 CTCTCTTTTCATGGTGGGTCTGG - Intronic
1153836399 18:8968207-8968229 CTCCATTTTCTTTTTGAGACAGG - Intergenic
1156161185 18:34360082-34360104 CTCCATTTTCATGCTGGGTTTGG - Intergenic
1156201650 18:34839479-34839501 CTCCATTTTCATTGTGACATAGG + Intronic
1156435425 18:37122703-37122725 CTCAATTTTCTCTGTGAATCAGG + Intronic
1159400847 18:67931717-67931739 CTCACTTTTCATTGTGAATTAGG + Intergenic
1164922589 19:32100298-32100320 CTCCATTTTGATTTTTAGTCTGG + Intergenic
1165533403 19:36422477-36422499 CATCATTTTCATTGTTGGTCAGG + Intergenic
927326263 2:21809350-21809372 CACCATTTTCATGGTGAGGCAGG + Intergenic
927521298 2:23699935-23699957 CTCCATTTTCTCTGTGAAGCAGG - Intronic
929582509 2:43091266-43091288 CTACATTCTCAATGTGAGGCTGG + Intergenic
930285993 2:49429180-49429202 CTCTCTTTTCTTTGTTAGTCTGG - Intergenic
930380202 2:50618139-50618161 CCTCATTTTCACTGTGAGCCAGG - Intronic
931538815 2:63305998-63306020 CTCTATTTTCTTTATTAGTCTGG - Intronic
931673998 2:64674839-64674861 CTACATTTTCATCATGATTCAGG - Intronic
931700610 2:64905994-64906016 GGCCATTTTCATTGTGAATCTGG - Intergenic
932074809 2:68653089-68653111 CTCCATTTTCATTGTGAGTCAGG + Intronic
932665724 2:73697095-73697117 AGCCATTTTCATTGTTACTCTGG - Intergenic
936232608 2:110716483-110716505 TTCCATTTTCATTGTGACTATGG + Intergenic
936263684 2:110982945-110982967 CTGCATTTTCATTTTGCGTTGGG + Intronic
936707161 2:115088452-115088474 CTCCTTTTTCTTTGAGAGACGGG + Intronic
936764225 2:115826201-115826223 CTCCATTTTGATTTTTAGTCTGG + Intronic
937414935 2:121706959-121706981 CTGCATTTTGATTGTGGGGCTGG + Intergenic
937616820 2:123934105-123934127 TTCCATTTTCAATGTGCTTCAGG - Intergenic
938772382 2:134511454-134511476 ATCCTTTTTGAATGTGAGTCAGG - Intronic
939095250 2:137826822-137826844 GGCCTTTTTCATTATGAGTCAGG + Intergenic
940446130 2:153779691-153779713 TTACCTTTTTATTGTGAGTCTGG - Intergenic
943355106 2:186845369-186845391 TTCCATTTTCATTTTATGTCAGG - Intronic
943736058 2:191355848-191355870 CTCCATCTCCATTGTGAGGAGGG - Intronic
943940055 2:193981472-193981494 TTCCATTTTCATAGTTAGTCTGG - Intergenic
944458972 2:199924395-199924417 CCCCATTTTCTGTGTGAGACAGG - Intronic
945004275 2:205386942-205386964 TTCCATTTTCATTTTTAGTTAGG - Intronic
947605492 2:231483146-231483168 CTGCATTTTCATTTTGCGCCAGG + Intronic
948722547 2:239910707-239910729 TTCCACTTTCATTTTGAGTTCGG - Intronic
1170943493 20:20868707-20868729 CTCCTTTTTTATTTTTAGTCTGG - Intergenic
1171933272 20:31247910-31247932 CTCCATTTTGATTTTTAGTCTGG + Intergenic
1172935073 20:38614379-38614401 GTCCATTTTTATTGTGGATCGGG + Intronic
1174142102 20:48422561-48422583 CTCCATTCTCATGGTGAGACTGG + Intergenic
1177327959 21:19617126-19617148 ATGCATTTTGAATGTGAGTCTGG - Intergenic
1178390935 21:32197692-32197714 CTCCCTTTTCATTTTGAGGGTGG + Intergenic
1184201083 22:42970181-42970203 CTCCTTTTTAAATGTGATTCAGG - Intronic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950263095 3:11555851-11555873 CTCAATTTTCACTTTGATTCTGG - Exonic
951346928 3:21558036-21558058 CTCCCTTTTCTTTATTAGTCTGG + Intronic
951737992 3:25888794-25888816 CTCCATATTCAATGTGAGGGAGG - Intergenic
952411413 3:33053160-33053182 CTCCATTTTTATTGAGGCTCAGG - Intronic
952507844 3:34023900-34023922 CTCCATGTTCATGCTGAGTGTGG + Intergenic
954595158 3:51818356-51818378 CTCCCATTTCCTTATGAGTCTGG + Intronic
955906569 3:63813984-63814006 CTAGATTTTTATTCTGAGTCTGG - Intergenic
955910121 3:63851444-63851466 CTCCATTTTGATTTTTAGTCTGG - Intronic
957282543 3:78172146-78172168 TTACATTTTCTTTCTGAGTCAGG - Intergenic
957592729 3:82221733-82221755 TTCATTTTTCATTGTGTGTCTGG + Intergenic
957659823 3:83134569-83134591 AGCCATTTTCATCTTGAGTCAGG + Intergenic
959534020 3:107465360-107465382 CTGCATTTTCATTTTGTATCAGG + Intergenic
959587962 3:108042874-108042896 CTCCATTTTAATTATCAGTTAGG - Intergenic
959942805 3:112096974-112096996 TTCCATGTCGATTGTGAGTCTGG - Intronic
960393758 3:117111351-117111373 CTCCATTTTCTTTGTTTCTCTGG - Intronic
962985113 3:140529157-140529179 CTGGAATTTCAGTGTGAGTCAGG - Intronic
965556392 3:170022717-170022739 CTCCATTCTGATTTTTAGTCTGG + Intergenic
968998259 4:3959452-3959474 CTCGATTTTTTTTTTGAGTCAGG - Intergenic
969337200 4:6518404-6518426 CTCCTTTTTCCTTGTTAGCCTGG - Intronic
970330233 4:14975053-14975075 CTCCACTGACATTGTGAGTGGGG + Intergenic
972601641 4:40578052-40578074 CTCCATTTTGATTTTCAGTCTGG - Intronic
974125294 4:57688621-57688643 ATCCATTTATATTGGGAGTCAGG - Intergenic
975601293 4:76102391-76102413 CTCCATTTCGATTTTTAGTCTGG + Intronic
975627731 4:76366221-76366243 GTCCCTTTTCATGGTGAGTTTGG + Intronic
978868545 4:113545797-113545819 CTCCATTCTTATTCTGATTCTGG - Intronic
979012015 4:115384080-115384102 ATCTTTTTTCTTTGTGAGTCTGG + Intergenic
980626923 4:135385652-135385674 CTCCATTTTGATTTTCAGTTTGG + Intergenic
981009718 4:139913049-139913071 CTACATTATCACTGTGTGTCAGG - Intronic
981043039 4:140240685-140240707 CTGGAATTTCACTGTGAGTCTGG - Intergenic
983258869 4:165433363-165433385 CTCCATTTTGATTTTTAGCCTGG + Intronic
983512111 4:168619986-168620008 AAACATTTACATTGTGAGTCAGG - Intronic
983741620 4:171141251-171141273 CTCCATTTTGGTTTTTAGTCTGG + Intergenic
983900336 4:173126914-173126936 CACTATTTACATTGTGGGTCAGG - Intergenic
984185401 4:176537372-176537394 CTCCATTATATTTGTGAGTCTGG - Intergenic
984314899 4:178116223-178116245 CTCCATTTTAATTTTTAGTTTGG - Intergenic
986885555 5:12230458-12230480 CTCCATGATCATTATGATTCTGG + Intergenic
987521438 5:18990147-18990169 CTCCATTTTCTTTGTCATTGTGG - Intergenic
987676433 5:21079046-21079068 CTCAATTTTCTCTGTGAGTTGGG - Intergenic
987914532 5:24194562-24194584 TTACATTTTCATTGTCAGTTGGG + Intergenic
988534972 5:32059096-32059118 CTGGATTTACATTCTGAGTCTGG + Intronic
989236102 5:39150131-39150153 CTCCATTTTGATTTTTAATCTGG - Intronic
989391022 5:40900782-40900804 AACCAATTTCTTTGTGAGTCTGG + Intergenic
992096215 5:73365482-73365504 CTCAATTGTCTTGGTGAGTCAGG - Intergenic
995962129 5:117854684-117854706 TTCCATGTTCACTGAGAGTCAGG - Intergenic
997222903 5:132184004-132184026 CTACATTTTCTTTTTGAGACAGG + Intergenic
997832981 5:137168076-137168098 CTCTTTTTTCTTTGTCAGTCTGG - Intronic
999228211 5:150045175-150045197 CTCCACTTTCTTTGTAAGACAGG + Intronic
1000039047 5:157471588-157471610 CCCCATTTTCTTTGGGACTCTGG + Intronic
1000326489 5:160176260-160176282 CTCCATTGTCACTGCGAGTGTGG + Intergenic
1001059374 5:168475418-168475440 CTCCATTCTGATTTTTAGTCTGG - Intergenic
1001199231 5:169700760-169700782 CTCCATTTTGATTTTCAGTCTGG - Intronic
1001579021 5:172785819-172785841 CACCATTTTCCTTGTGACTTTGG + Intergenic
1001616093 5:173044847-173044869 CTCCATTTTGATTTTTAGCCTGG + Intergenic
1002430393 5:179200060-179200082 CCACATTTTCATTGTGCGTTGGG + Intronic
1004080448 6:12387160-12387182 CTCTACATTCAGTGTGAGTCAGG - Intergenic
1005241751 6:23838059-23838081 CTTCATTTTTGTTGTGAGTTGGG + Intergenic
1005533046 6:26727858-26727880 CTGCTTTTTCAATCTGAGTCGGG - Intergenic
1005537748 6:26773806-26773828 CTGCTTTTTCAATCTGAGTCGGG + Intergenic
1007932114 6:45700711-45700733 CTCCTATTTCATTGGGAATCTGG + Intergenic
1009006446 6:57793789-57793811 CTGCTTTTTCAATCTGAGTCGGG + Intergenic
1009008619 6:57816219-57816241 CTGCTTTTTCAATCTGAGTCGGG + Intergenic
1009963978 6:70558152-70558174 CTTAGTTTTCATTTTGAGTCAGG - Intronic
1010395881 6:75391468-75391490 TTCAATTTTCTTGGTGAGTCAGG - Intronic
1010668586 6:78658643-78658665 CTCCATCTTCATGGTGAGAATGG + Intergenic
1011247184 6:85331758-85331780 CTCCATTTTCATTTTGCGCTGGG - Intergenic
1013088874 6:106881155-106881177 CTCCATTTTGATTTTTACTCTGG - Intergenic
1015239219 6:131005404-131005426 CTCCAGCTTCATTGTCAGACTGG - Intronic
1015538526 6:134291337-134291359 CTCCATTTTGATTTTTAGTCCGG - Intronic
1015641050 6:135332540-135332562 CTTCATTTTGATTGTTAGTCTGG - Intronic
1016342199 6:143075180-143075202 CTCCTTTTTCTTTATCAGTCTGG + Intronic
1017580818 6:155863280-155863302 CTCTTTTTTCATTGTTAATCTGG - Intergenic
1018202824 6:161411091-161411113 CTCTAGTTTCACTGTGAGGCAGG + Intronic
1018868150 6:167761113-167761135 CTCTACCTTCATTCTGAGTCAGG - Intergenic
1020712173 7:11620980-11621002 CTCCCATTTCATTATGAGGCTGG - Intronic
1021507930 7:21405769-21405791 CTTCATTTTGATTTTTAGTCTGG - Intergenic
1023537227 7:41226092-41226114 CTCCATTTTAGTTTTTAGTCTGG - Intergenic
1024891893 7:54212823-54212845 CACCCTTTTCATTGTGATTGAGG - Intergenic
1028325263 7:89516573-89516595 CTACATTTTAATTCTGATTCTGG - Intergenic
1028847805 7:95501930-95501952 CTCTATTTTCTTTGTGAATTCGG - Intronic
1029232360 7:99081032-99081054 GCCCATGTTCATTGTGAGTTGGG - Intronic
1031112534 7:117629690-117629712 CTCCATTTTTACTTTTAGTCTGG + Intronic
1031861930 7:126989943-126989965 CCCCATTTTTTTTTTGAGTCAGG - Intronic
1032304853 7:130723008-130723030 CTCCATGTTCAGTGTGACACTGG + Intergenic
1032639272 7:133747989-133748011 CTCCTTTTTCAGTATGAGACAGG - Intronic
1034258560 7:149738781-149738803 CACCTTTTTCATTCTGAGACTGG - Intergenic
1036145992 8:6255335-6255357 CTCCTTTTTCATTGTACTTCTGG - Intergenic
1036850581 8:12198094-12198116 CTCAATTTTTTTTTTGAGTCAGG - Intergenic
1036871946 8:12440359-12440381 CTCAATTTTTTTTTTGAGTCAGG - Intergenic
1037392272 8:18405855-18405877 CTCCATTGTGATTTTTAGTCTGG + Intergenic
1043946084 8:86254214-86254236 CACCATTTTGATTTTTAGTCTGG - Intronic
1045373933 8:101552537-101552559 CTCCATAATCATTGTCACTCAGG + Intronic
1045451394 8:102330242-102330264 CTCCATTTTCTTTGGGATTCTGG + Intronic
1047185741 8:122631692-122631714 CTACATTTTCATTCTGAGTTGGG + Intergenic
1048553649 8:135456196-135456218 CTCCATTTGCATTGGGAGTGCGG + Intergenic
1050118554 9:2285286-2285308 CTGAATTTCCATTGTGTGTCAGG - Intergenic
1050364430 9:4861243-4861265 CTCCATGTCCACTGTGAGACAGG - Intronic
1051990775 9:23149933-23149955 CTCCCTTTTTATTCTCAGTCTGG + Intergenic
1057417277 9:94876190-94876212 ATTCATTTTCATTGTTAGCCTGG + Intronic
1059246758 9:112855787-112855809 CTCCATGTTAATTGTGAGGTTGG + Intronic
1059479752 9:114579916-114579938 TTCCATTTTGATTTTTAGTCTGG - Intergenic
1059547418 9:115192161-115192183 ATCCGTTATCATTGTGAGTTTGG + Intronic
1059990292 9:119858899-119858921 ACACATTTTCATTGTGTGTCTGG - Intergenic
1059999821 9:119948143-119948165 CTCCATTTTCATTGTTTTTTTGG + Intergenic
1186160262 X:6770039-6770061 TTCCATTTTCATTTTGTTTCTGG + Intergenic
1186606117 X:11093678-11093700 CTCCAATTTCATTATGATTTTGG + Intergenic
1187385171 X:18842050-18842072 CTCCACTTTGATTTTTAGTCTGG - Intergenic
1187627293 X:21130202-21130224 TTCCATTTTCTTAGTGAGTCAGG - Intergenic
1188112718 X:26211062-26211084 CTCCATTTTCTTTGCGTGTCGGG + Intergenic
1188261351 X:28028410-28028432 CTCTTTTTTCTTTGTCAGTCTGG + Intergenic
1189148176 X:38676367-38676389 CTCTAATTTCTTTGGGAGTCGGG - Intronic
1189623354 X:42868188-42868210 CTGCATTTTTATTCAGAGTCTGG + Intergenic
1189810313 X:44775363-44775385 CTCCATTTTGACTTTTAGTCTGG + Intergenic
1192498644 X:71633838-71633860 CTCACTTTTTATTGTGAGGCTGG + Intergenic
1194664742 X:96665039-96665061 CTCTGTTTTCCTTGTGAGACAGG - Intergenic
1197705101 X:129629258-129629280 CTCTATTTTCAGTGTGTGTTTGG - Intergenic
1200676734 Y:6155929-6155951 CTCCATTTTCTTGGTTAATCTGG + Intergenic