ID: 932075508

View in Genome Browser
Species Human (GRCh38)
Location 2:68659220-68659242
Sequence ACACTGTGGTAGAAGAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932075508_932075514 12 Left 932075508 2:68659220-68659242 CCAGGGCTCTTCTACCACAGTGT No data
Right 932075514 2:68659255-68659277 GGAGCATCAGAGTCTTACAAAGG No data
932075508_932075516 17 Left 932075508 2:68659220-68659242 CCAGGGCTCTTCTACCACAGTGT No data
Right 932075516 2:68659260-68659282 ATCAGAGTCTTACAAAGGGCAGG No data
932075508_932075515 13 Left 932075508 2:68659220-68659242 CCAGGGCTCTTCTACCACAGTGT No data
Right 932075515 2:68659256-68659278 GAGCATCAGAGTCTTACAAAGGG No data
932075508_932075510 -10 Left 932075508 2:68659220-68659242 CCAGGGCTCTTCTACCACAGTGT No data
Right 932075510 2:68659233-68659255 ACCACAGTGTTCCTGGATGCAGG No data
932075508_932075512 -9 Left 932075508 2:68659220-68659242 CCAGGGCTCTTCTACCACAGTGT No data
Right 932075512 2:68659234-68659256 CCACAGTGTTCCTGGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932075508 Original CRISPR ACACTGTGGTAGAAGAGCCC TGG (reversed) Intergenic
No off target data available for this crispr