ID: 932076111

View in Genome Browser
Species Human (GRCh38)
Location 2:68664406-68664428
Sequence TGTGCTTCCATCACAGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932076103_932076111 19 Left 932076103 2:68664364-68664386 CCTTTAGTTTGTTCCTCTACGAT No data
Right 932076111 2:68664406-68664428 TGTGCTTCCATCACAGTGAGGGG No data
932076104_932076111 6 Left 932076104 2:68664377-68664399 CCTCTACGATGTCTACCTCCCAC No data
Right 932076111 2:68664406-68664428 TGTGCTTCCATCACAGTGAGGGG No data
932076105_932076111 -9 Left 932076105 2:68664392-68664414 CCTCCCACAACCAGTGTGCTTCC No data
Right 932076111 2:68664406-68664428 TGTGCTTCCATCACAGTGAGGGG No data
932076102_932076111 30 Left 932076102 2:68664353-68664375 CCATAAGGGAACCTTTAGTTTGT No data
Right 932076111 2:68664406-68664428 TGTGCTTCCATCACAGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932076111 Original CRISPR TGTGCTTCCATCACAGTGAG GGG Intergenic
No off target data available for this crispr