ID: 932077844

View in Genome Browser
Species Human (GRCh38)
Location 2:68681725-68681747
Sequence ATTTCAATGGGAAAAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 416}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932077834_932077844 28 Left 932077834 2:68681674-68681696 CCATACGTGTTTGACAGCTCAAA 0: 1
1: 0
2: 1
3: 3
4: 62
Right 932077844 2:68681725-68681747 ATTTCAATGGGAAAAGTGGATGG 0: 1
1: 0
2: 1
3: 44
4: 416
932077833_932077844 29 Left 932077833 2:68681673-68681695 CCCATACGTGTTTGACAGCTCAA 0: 1
1: 0
2: 0
3: 2
4: 47
Right 932077844 2:68681725-68681747 ATTTCAATGGGAAAAGTGGATGG 0: 1
1: 0
2: 1
3: 44
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932077844 Original CRISPR ATTTCAATGGGAAAAGTGGA TGG Intronic
900364497 1:2305565-2305587 ATTTTAATGGGGAGAGTGGGGGG + Intronic
901839911 1:11947718-11947740 ATTTCAATGTGCAATTTGGAGGG + Intronic
902107590 1:14050722-14050744 AGCTCAATGGGGGAAGTGGAGGG - Intergenic
902476519 1:16691405-16691427 ATTTCTGTGGGACAAGTGGATGG + Intergenic
903614933 1:24644461-24644483 TTTTCAAAGGAAAAATTGGAAGG + Intronic
904175025 1:28621223-28621245 ATTTCAAGGGAATGAGTGGAGGG - Intronic
904967763 1:34391934-34391956 ACTTCAATGGGAAAGGGGAAAGG + Intergenic
908026568 1:59958296-59958318 ATTCCAAAGGGCACAGTGGAAGG - Intergenic
908807741 1:67948438-67948460 CCTTGAATGTGAAAAGTGGATGG - Intergenic
908897812 1:68920373-68920395 ATTTCAATGACAAAACTGGCAGG - Intergenic
910170767 1:84374412-84374434 ATTTCAATAGGAAATGTTTAAGG - Intronic
911951253 1:104176656-104176678 ACTTCATTTGGAAAAGAGGATGG - Intergenic
912515814 1:110216034-110216056 ATTTCCATAGGAAAAATGAAGGG + Intronic
912556263 1:110518306-110518328 ATATCAATGGGAACATTGGCTGG + Exonic
912635745 1:111290979-111291001 ATTGCAATGGGAAAGGGAGAAGG - Intronic
913309505 1:117474263-117474285 ATGTAAATGGGAAAAGTAGGTGG - Intronic
915388679 1:155520450-155520472 ATTTAAATGGGCAAACTGTATGG + Intronic
916271750 1:162950464-162950486 ATTCCAAAGGGAAAAGTGGCAGG + Intergenic
917956528 1:180104995-180105017 ATTGTAAAGGGAAAATTGGAGGG - Intronic
918295039 1:183148622-183148644 ATGTCCATGGAAAAAGTGGTGGG - Intergenic
918799295 1:188952187-188952209 ATTTCAATGACTCAAGTGGATGG - Intergenic
919074566 1:192797885-192797907 ATTTCAATAGGAGATTTGGAGGG - Intergenic
919208499 1:194450176-194450198 CTTTCCAGGAGAAAAGTGGAAGG + Intergenic
919550595 1:198981154-198981176 ATTTCTATGAGAAAGGGGGAGGG + Intergenic
919581496 1:199380790-199380812 TTTTCAATGGGTAAATTGTATGG - Intergenic
921728745 1:218553296-218553318 GTTCCAAAGGGCAAAGTGGAAGG - Intergenic
922081605 1:222302979-222303001 ATTTCAATAAGACAAGTGGAGGG - Intergenic
922380204 1:225015750-225015772 ATTGCAATGGGAAGAGGAGAAGG + Intronic
924906990 1:248465631-248465653 ATTTCAATTAGTAAAGTTGAAGG - Intergenic
924917121 1:248582508-248582530 ATTTCAATAAGTAAAGTTGAAGG + Intergenic
1063228138 10:4035177-4035199 ATTTAAAAGGGAAAAGTGGGAGG - Intergenic
1063705568 10:8427230-8427252 AGTTCAATGGAAAAAGAAGAAGG - Intergenic
1064319135 10:14285758-14285780 ACTTCAGTGGAAAAAGTGAAAGG - Intronic
1064512551 10:16111232-16111254 GTTTCACTGGGATAAGTTGAAGG - Intergenic
1065111048 10:22440132-22440154 ATTTAAATGTGAAATGTGGAAGG - Intronic
1066052539 10:31648798-31648820 ATTTCATTAGGGAAGGTGGAGGG + Intergenic
1066441280 10:35441461-35441483 TTTTCAATGGAAAAAGCGGTAGG + Intronic
1067128490 10:43540662-43540684 ATTTCAACATGAAATGTGGAGGG - Intergenic
1067354059 10:45507677-45507699 ATTTCAATATGAAATTTGGAGGG + Intronic
1067811353 10:49429410-49429432 ATTTCAATGTGAGATTTGGAGGG + Intergenic
1067971192 10:50972860-50972882 ATTCTAATGGGAAAAGTAGCAGG - Intergenic
1068530179 10:58176809-58176831 AGTTCAATGGTTAAGGTGGAAGG - Intergenic
1068766400 10:60769297-60769319 AATCCAATGGGAAGAATGGAAGG - Intergenic
1069335040 10:67338464-67338486 ATTTCAACATGAAATGTGGAGGG + Intronic
1070834026 10:79436740-79436762 ATTTCCATGGGCCGAGTGGAGGG + Intronic
1071764123 10:88642712-88642734 ATTTCACTAGGAATTGTGGAAGG + Intergenic
1071871314 10:89797664-89797686 ATTGCAATGGGAAAGGGAGAAGG - Intergenic
1074834088 10:117272528-117272550 GTTTAAATGGGGAAAGAGGAGGG - Intronic
1075581328 10:123620673-123620695 ATATCAATGGAGGAAGTGGATGG - Intergenic
1077196147 11:1281371-1281393 TTTTCACTGAGGAAAGTGGACGG + Intronic
1077823304 11:5774614-5774636 ATTCCAGAGGTAAAAGTGGAGGG + Intronic
1078178551 11:8989617-8989639 GTATCTTTGGGAAAAGTGGAGGG + Intronic
1080231382 11:30020279-30020301 ATTTAAATGGGCAAAGAGGTAGG - Intergenic
1080435548 11:32238605-32238627 ATTTCAATGTGAAATTTGGAGGG - Intergenic
1081217997 11:40425850-40425872 ATTTAAATGAGACAAGTGGGTGG - Intronic
1081280983 11:41209035-41209057 ATTTGAAGGGGAAAGGTGGGAGG + Intronic
1081411614 11:42765249-42765271 CTCTCAATGGGAGAAGTGTATGG + Intergenic
1082688086 11:56264392-56264414 ATTTCACTGGGGATAGTGGGTGG - Intergenic
1082943636 11:58735171-58735193 ATTTCAATGTGAGATTTGGAGGG - Intergenic
1083321077 11:61847228-61847250 CTTTAAATGGGAAAACTGGCTGG - Intronic
1083336709 11:61926424-61926446 ATTTCAATGTGAAATTTGGAGGG - Intergenic
1085710504 11:78824804-78824826 ATTTCAATATGAAATTTGGATGG + Intronic
1086584711 11:88437350-88437372 ATTTCAATGTGAGATTTGGAGGG + Intergenic
1086598417 11:88603214-88603236 ATTCCAATGGGAAACCTTGATGG - Intronic
1087517280 11:99180248-99180270 ATTGCAATGGGAAAGGGAGAAGG + Intronic
1088225245 11:107613001-107613023 GATTGAATGGGAAAAGTGAAGGG - Intronic
1090176958 11:124658703-124658725 ATTTGAATGTGAAGAGTGGTAGG + Intronic
1092012205 12:5123853-5123875 ATTGCTAAGGGAAAATTGGAGGG - Intergenic
1092774958 12:11935753-11935775 TTTAAAATGGGCAAAGTGGAAGG + Intergenic
1093231155 12:16543780-16543802 GTTTCAATGGGAAAAATGTAAGG + Intronic
1093833746 12:23800274-23800296 ATGTCAATGAGAATAATGGAGGG + Intronic
1096604734 12:52756476-52756498 ATTGAAATGGGAACTGTGGAGGG + Intergenic
1098118841 12:67212830-67212852 AATTCAATGAGAAAAGGGTAGGG + Intergenic
1098188060 12:67919513-67919535 ATTGCAATGGGAAAATCAGAAGG + Intergenic
1098271285 12:68772738-68772760 ATTTCAAAAGGAAAAGTCTACGG - Exonic
1098390868 12:69968600-69968622 ATTTCAAAGGAAAAAGTAGTTGG + Intergenic
1098427503 12:70381850-70381872 CTTTTAATGGGTAAATTGGATGG + Intronic
1099176559 12:79429144-79429166 ATTTCAATATGAAATTTGGAGGG + Intronic
1099181029 12:79472868-79472890 AATTCCAGGGGAAAAGAGGATGG + Intergenic
1099297608 12:80849182-80849204 ATTTCTATGGGAAATCTGAATGG + Intronic
1099847015 12:88040214-88040236 ATTCCAACAGAAAAAGTGGATGG + Exonic
1100030087 12:90176222-90176244 ATTTAAATGGAAAAAGTAGAAGG - Intergenic
1101062648 12:100988036-100988058 TTTTCAATGGGAAAAGGTGTAGG - Intronic
1102566792 12:113802353-113802375 ACTTCAATGGGGGAGGTGGAGGG + Intergenic
1104190848 12:126480571-126480593 ATTTCCAAGGAAAAAGAGGAGGG - Intergenic
1104549467 12:129743254-129743276 AATTCAAGATGAAAAGTGGATGG - Intronic
1105263425 13:18796526-18796548 ATTTTAATGGGAAATGTTAAAGG - Intergenic
1105782128 13:23714729-23714751 GTGCCAAAGGGAAAAGTGGATGG - Intergenic
1105968107 13:25403113-25403135 ATTTCAATACGAACTGTGGAGGG + Intronic
1106544526 13:30718517-30718539 ATTCCAAAGGGCACAGTGGATGG - Intronic
1107285633 13:38787563-38787585 TTTTGATTGGGGAAAGTGGAAGG - Intronic
1108916319 13:55617298-55617320 ATTGGAATGGGAAAAAGGGAAGG - Intergenic
1110894169 13:80728380-80728402 ATTTCCATAGTAAAAATGGATGG - Intergenic
1111036822 13:82685181-82685203 ATTTTCATGAGAAAAGTGTAGGG - Intergenic
1111063226 13:83052041-83052063 ACTTCAGTGGGAAAGGTAGAAGG - Intergenic
1111151029 13:84253862-84253884 ATTTCTTTGGGGAAAATGGAAGG - Intergenic
1111445141 13:88338016-88338038 ATTTCTAGGGGAAATGGGGAGGG - Intergenic
1111984957 13:95056609-95056631 AATTCAAAGGGAAAAGAGGTAGG - Intronic
1114160832 14:20165240-20165262 ATTTCAATGGTAAAGGTGTTGGG + Intergenic
1115049136 14:29035127-29035149 ATTTCAATGGGAAAATATGTTGG + Intergenic
1115268415 14:31525813-31525835 ATTTCAATATGAAATTTGGATGG + Intronic
1115663034 14:35516017-35516039 ATCTCTATGACAAAAGTGGAAGG + Intergenic
1116334333 14:43638526-43638548 ATGCAACTGGGAAAAGTGGAAGG + Intergenic
1116518078 14:45822899-45822921 ATTTCCAGGGGTAAAGAGGATGG + Intergenic
1116731601 14:48629767-48629789 ATTTGATTGGTTAAAGTGGAAGG - Intergenic
1118166162 14:63338811-63338833 ATTTCAAGGGGAAAAGGGAAAGG + Intergenic
1118446294 14:65854060-65854082 ATTTCAAAGGGAAAAGAAGCTGG - Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119901776 14:78266819-78266841 TTTTTAATGGGAGAAATGGAGGG + Intronic
1120055849 14:79923399-79923421 ATTTCCAAGGGCAAAGTCGAGGG - Intergenic
1120766779 14:88334658-88334680 GTTTTAATGGCAAATGTGGAGGG - Intergenic
1121361626 14:93266595-93266617 TTTTTAATGGGAGAAGAGGATGG - Intronic
1122080593 14:99264441-99264463 ATTTCAATAAAATAAGTGGAAGG + Intronic
1122477332 14:102019868-102019890 ATGGCAATGAGAAAAATGGAAGG - Intronic
1122872940 14:104649680-104649702 AATTCTGTGGGCAAAGTGGAGGG - Intergenic
1123099469 14:105786707-105786729 ATTTCAATGTGAAATTTGGAGGG - Intergenic
1123457689 15:20440796-20440818 AATTCAAAGTGAGAAGTGGAAGG + Intergenic
1123660382 15:22559622-22559644 AATTCAAAGTGAGAAGTGGAAGG - Intergenic
1124263837 15:28215950-28215972 AATTCAAAGTGAGAAGTGGAAGG + Intronic
1124314239 15:28654111-28654133 AATTCAAAGTGAGAAGTGGAAGG - Intergenic
1124809676 15:32922918-32922940 ATTTTAATGGGGAAAATGGCAGG + Intronic
1125002722 15:34787837-34787859 AATTCTATGGGAGAACTGGAAGG + Intergenic
1125047760 15:35262223-35262245 TTTTAAATGGGAAATCTGGAAGG - Intronic
1125334199 15:38611661-38611683 CCTTCCATGGGAAAAGTTGATGG - Intergenic
1126323581 15:47450656-47450678 GTTTCAATTATAAAAGTGGAAGG + Intronic
1126363118 15:47866351-47866373 ATTTCAATGTGAAGTTTGGAGGG + Intergenic
1129311623 15:74716447-74716469 ATTGAAATGGGACATGTGGAGGG - Intergenic
1129473688 15:75768910-75768932 ATTTCAACACGAAATGTGGATGG - Intergenic
1130406745 15:83609548-83609570 ATTTCAAGGGGCAAAGGGGATGG - Intronic
1131523198 15:93132363-93132385 CTTTCAATGGGCAAATTGTATGG - Intergenic
1131551541 15:93361450-93361472 CTTTCAATGGGTAAATTGAATGG - Intergenic
1131566888 15:93493974-93493996 AGTTCTATGGGAAAATTGGATGG + Intergenic
1133105344 16:3504498-3504520 AGTTCAATGGGAGAAGTAGATGG - Intronic
1133610597 16:7429721-7429743 TTTTTATTGGGAAAAGTGCATGG + Intronic
1137885230 16:52095846-52095868 ATTTCAATGTGATATTTGGAGGG - Intergenic
1137994994 16:53200575-53200597 ATTCCAATTGAAAATGTGGAAGG + Intronic
1140517818 16:75556944-75556966 ATTGCAATGGGAAGAGGAGAAGG - Intergenic
1141290768 16:82716302-82716324 TTTTCCATGGGAAAGGTGGTGGG + Intronic
1144518866 17:15941124-15941146 CTTTCACTGGTGAAAGTGGAAGG - Intergenic
1144752239 17:17657063-17657085 ATTTCAACATGAAATGTGGAGGG + Intergenic
1145059251 17:19722013-19722035 ATGTCAATGGGGAAACTGGTGGG + Intergenic
1146200498 17:30853193-30853215 ATTTCAATATGAAATTTGGAGGG + Intronic
1146671642 17:34741942-34741964 CTTTCAAGGGGAAGAATGGATGG + Intergenic
1148244722 17:46023132-46023154 ATTGCAAAGGAAAATGTGGAAGG - Intronic
1149151886 17:53575305-53575327 ATTTGAAAGGCTAAAGTGGAAGG - Intergenic
1149328977 17:55561776-55561798 ATTTGAGTGGTAAAGGTGGATGG + Intergenic
1151001202 17:70378821-70378843 CTATGAATGGGAAAAGTGGAGGG + Intergenic
1151606091 17:75137172-75137194 AATTCATTTGGAAAATTGGATGG - Intronic
1152208097 17:78987112-78987134 ATTTCAAAGGAAAAAATGGTGGG + Intergenic
1152219081 17:79051048-79051070 ATTCCCATGGGAAAAGAGGCAGG + Intergenic
1154430342 18:14303747-14303769 ATTTTAATGGGAAATGTTAAAGG + Intergenic
1154432605 18:14320097-14320119 ATTTTAATGGGAAATGTTAAAGG + Intergenic
1157672749 18:49544009-49544031 ACTTCAATGTGTAAAGTGGCTGG - Intergenic
1157745878 18:50135042-50135064 ATTTAAAGAGGAAGAGTGGAGGG - Intronic
1158233842 18:55290177-55290199 AATTCAAAGGGAAAAGGGTAGGG - Intronic
1158248477 18:55459049-55459071 CTTTCACTGGGAACAGTGGGTGG + Intronic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1158754207 18:60302593-60302615 ATTCCAGTGAGAAAAGAGGAAGG - Intergenic
1159088557 18:63821247-63821269 TTTCCAATGGGAAATGGGGATGG + Intergenic
1159486640 18:69068730-69068752 CTTTCAATGGGAAAAACTGATGG - Intergenic
1159562051 18:70006561-70006583 ATTCTAATGGGAAAAGAGGGGGG - Intronic
1159989741 18:74890741-74890763 ATTTGAATGGGAAAAGAGAGAGG + Intronic
1160309679 18:77777922-77777944 ATTTCAAGAGGAAAAATGGAAGG + Intergenic
1160536871 18:79599179-79599201 ATTTCTAAGGTCAAAGTGGAAGG + Intergenic
1161681680 19:5682790-5682812 AAGTCAATGGGACAAGGGGAAGG - Intronic
1163578897 19:18126460-18126482 CTTTCAATGGGGACAGTGGCAGG - Intronic
1163888537 19:19990676-19990698 ATTGCAATGGGAAAGGGAGAAGG + Intergenic
1163934753 19:20432742-20432764 ATTGCAATGGGAATAGGAGAAGG - Intergenic
1163935810 19:20442078-20442100 ATTGCAATGGGAAGAGGAGAAGG + Intergenic
1164188849 19:22897041-22897063 ATTTTTATGGGAAAGGGGGAAGG + Intergenic
1165084057 19:33330365-33330387 AATTCAATGGGAAAAGGAGGGGG + Intergenic
1165117916 19:33540126-33540148 ATTTTAAAGGGAAAAGGGGGTGG - Intergenic
1165683900 19:37801492-37801514 ATTTCAGTAGGAAAAGAGAAAGG - Intronic
1166823123 19:45592608-45592630 ATTTCAATGGGGGCAGGGGAGGG + Exonic
1167390550 19:49191808-49191830 ATTTCAATGTGAGATTTGGAAGG + Intronic
1167413351 19:49357658-49357680 ATTTCAATATGAAATTTGGAAGG - Intronic
1202637691 1_KI270706v1_random:56180-56202 ATTTTAATGGGAAATGTTAAAGG - Intergenic
1202710538 1_KI270714v1_random:17246-17268 ATTTCTGTGGGACAAGTGGATGG + Intergenic
926608489 2:14921945-14921967 ATTTGAATAGGAACAGTGGTAGG - Intergenic
926612342 2:14958941-14958963 ATTGCAGTGGGAAAGGAGGAAGG + Intergenic
926807570 2:16725326-16725348 ATTTCAGTGGGAGAATTGGAAGG + Intergenic
927234537 2:20858482-20858504 ATTCCAATGGTAAAAGTGAGAGG + Intergenic
927816544 2:26222490-26222512 ATTTCAATGATCAAAGTGGATGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929216706 2:39421838-39421860 ATTTAAATGGATAAAGTGGAAGG - Intronic
929426032 2:41845651-41845673 ATTCCAAGGGGAAGAGTGCAGGG - Intergenic
929608551 2:43252583-43252605 ATTTCAGTGGAAAAGGTAGAAGG - Intronic
929914376 2:46121978-46122000 ATCTCAATGGGAAAAAAGGAGGG - Intronic
930449853 2:51521899-51521921 ATCTCAAAGGGACAAGTGGATGG - Intergenic
932077844 2:68681725-68681747 ATTTCAATGGGAAAAGTGGATGG + Intronic
932217731 2:69977765-69977787 AGTTCAATGGGAAAGTTGGGTGG + Intergenic
932472917 2:71974529-71974551 ATTTAAATGGAAAAAGGGAATGG + Intergenic
932710248 2:74057833-74057855 AATTCTGTAGGAAAAGTGGAGGG + Intronic
933336672 2:80967688-80967710 ATTTCAATATGAAATTTGGAGGG + Intergenic
934038582 2:88109059-88109081 ATTTCAATGTGAGATTTGGAAGG + Intronic
935965049 2:108464717-108464739 AGGTCTATGGGAAAAATGGAAGG + Intronic
936470381 2:112793268-112793290 ATTTCAATGTGAGATTTGGAGGG - Intergenic
936837025 2:116721389-116721411 ATTTCAATGGGAATCGAAGAAGG - Intergenic
938340631 2:130533759-130533781 ATTTCAACGGGTAGAGTGGGCGG - Intergenic
938349199 2:130586960-130586982 ATTTCAACGGGTAGAGTGGGCGG + Intergenic
938838203 2:135129855-135129877 TTTTCAATGGAAAAACTGAATGG + Intronic
938873654 2:135509751-135509773 ATTTCAATGGTAAAAACGGTAGG + Intronic
938960338 2:136335132-136335154 ATGTCAATGGGAAACAGGGAGGG - Intergenic
940075419 2:149736031-149736053 ATTTCTATGGGACAATTGGCTGG + Intergenic
940898122 2:159100704-159100726 ATTTTAATTGGAAAAGTTTAGGG + Intronic
941293448 2:163704948-163704970 ATTTTAATGCTAAAATTGGATGG - Intronic
941531901 2:166680630-166680652 ATTAAAATGGAAAAAATGGATGG + Intergenic
941826466 2:169902956-169902978 GCTGCAATGGGAAAAGTAGAGGG - Intronic
942091410 2:172495108-172495130 AGTTCAATGAGAACAGTGGGTGG + Intronic
943088031 2:183337949-183337971 AAGTCAATGGCAAAAATGGAAGG + Intergenic
943409139 2:187523743-187523765 ACTTCAAAGGGAATAGAGGAGGG - Intronic
943418125 2:187634764-187634786 ATTTCAGAGGCCAAAGTGGAAGG + Intergenic
943593813 2:189831237-189831259 TTTTAAATGAGAAAATTGGAAGG + Intronic
943837909 2:192538502-192538524 ATTTCAAGAAGAAAAGTGGTAGG - Intergenic
945365427 2:208946918-208946940 TGTCCAATGGGAAAAGTGAATGG + Intergenic
945619858 2:212121822-212121844 ATTTCAATGGGAGTAGTATAAGG - Intronic
945743898 2:213697200-213697222 ATTTGAAAGGGAAGAGTGGGTGG + Intronic
945979463 2:216297347-216297369 ATCGGAATGGGAAAACTGGAAGG - Intronic
947364451 2:229379860-229379882 ATTTCAATGGTAAAATTCTAAGG - Intronic
947678716 2:232009893-232009915 ATTTCAAGGGCAAAAAAGGAGGG - Intronic
949061066 2:241957615-241957637 ATTTCAACGTGAGATGTGGAGGG + Intergenic
1168968984 20:1917912-1917934 ATCTCAAAGGGAAAAAGGGAAGG + Intronic
1169754796 20:9032518-9032540 ACTGCTCTGGGAAAAGTGGATGG - Intergenic
1170145465 20:13169174-13169196 ATTCCACTGGGAAAATTGGTAGG + Intergenic
1170212745 20:13861525-13861547 CTTTAAATGGGTAAATTGGATGG - Intronic
1171884266 20:30640270-30640292 ATTTTAATGGGAAATGTTAAAGG - Intergenic
1173600531 20:44291916-44291938 ATTCCAATGGTAAGAATGGAGGG + Intergenic
1173656579 20:44703995-44704017 TTTTCAATGGGAAGAGTGAGAGG - Intergenic
1174924887 20:54748429-54748451 ATTTCAATGTGAGATTTGGAGGG + Intergenic
1175637804 20:60600189-60600211 ATTTCAACGTGAGATGTGGAGGG + Intergenic
1176844436 21:13865651-13865673 ATTTTAATGGGAAATGTTAAAGG - Intergenic
1176847155 21:13885214-13885236 ATTTTAATGGGAAATGTTAAAGG - Intergenic
1177372714 21:20225651-20225673 ATATGAATGGGAAATTTGGATGG - Intergenic
1177486952 21:21770753-21770775 ATTTACATATGAAAAGTGGAAGG - Intergenic
1177627389 21:23680610-23680632 ATATCCAAGGGAAAATTGGATGG - Intergenic
1177939563 21:27391805-27391827 ATTTCAAAGGGAAAAGTACCAGG - Intergenic
1179144536 21:38756043-38756065 ATTTCATTGGTTAAAATGGAGGG - Intergenic
1179638881 21:42733858-42733880 ATTTCAACGTGAGATGTGGAGGG - Intronic
1181038412 22:20180660-20180682 ATTTCAATGCCACATGTGGAAGG - Intergenic
1181449073 22:23005118-23005140 ATATAAATGGGAAGAGTGGGCGG + Intergenic
1182351716 22:29703537-29703559 CCTTCCATGGGAAAAGAGGAGGG - Intergenic
1184946134 22:47805432-47805454 ATTTCAATGTGAGATTTGGAGGG + Intergenic
1185107174 22:48880033-48880055 AGTTCAAGGGCAAAACTGGAAGG - Intergenic
949338201 3:2999876-2999898 ATTTCAATAGGAAAAGTTTGAGG - Intronic
949910499 3:8902196-8902218 ATTACTATGGGGAAAGTGGTTGG - Intronic
950270976 3:11614605-11614627 ATTTCCGTGGGAAACCTGGATGG - Intronic
951597720 3:24336029-24336051 TTTCCAATGGGAAAAGGAGAGGG + Intronic
951995227 3:28720204-28720226 ATTTCAGAGGGCAAAGGGGATGG - Intergenic
952157267 3:30656822-30656844 ATTTCAATTGGAAAAGGGGTGGG - Intronic
952670562 3:35962108-35962130 ATTTCAATGTGAGATTTGGAGGG + Intergenic
952868745 3:37877968-37877990 ATTTCAACATGAAATGTGGAGGG + Intronic
953045084 3:39287649-39287671 ATTTGAATGGGTCAAATGGAAGG + Intergenic
953097831 3:39796027-39796049 ATTTAAACAGGAAATGTGGAAGG - Intergenic
953210341 3:40869799-40869821 ATTTAAAAGGGAGAAGTGAATGG + Intergenic
953349654 3:42205870-42205892 AGTTCTATGGGAAAAGGGCACGG - Intronic
953469052 3:43151325-43151347 AGTTCAAGGGGACAAATGGAAGG + Intergenic
953628228 3:44588423-44588445 ATTTCAATGTGAGATTTGGAAGG + Intronic
955717625 3:61847209-61847231 ATGTAAATGGGAAATTTGGATGG + Intronic
955807326 3:62750704-62750726 ATTTCTATGGGAACAAAGGATGG - Intronic
956064013 3:65378044-65378066 AATACAATGGGAGAAGGGGAAGG - Intronic
956326023 3:68054146-68054168 ATTTCAATGTGAAATTTGGAAGG - Intronic
956556014 3:70523824-70523846 CTTTCAATGTGAAAAATGAAAGG - Intergenic
957928720 3:86849532-86849554 AGTTCAATGGGAGATTTGGAGGG - Intergenic
958505515 3:94972436-94972458 ATTTCAGTGTGAAATTTGGAGGG + Intergenic
958699659 3:97571855-97571877 AGGTCAATGTGAAATGTGGAAGG + Intronic
958761759 3:98317550-98317572 ATTTCAATTGTAAATGAGGATGG - Intergenic
959337834 3:105088680-105088702 ATTTCAATGGGAGATTTGGAGGG - Intergenic
959712251 3:109396763-109396785 ATTCCAACAGAAAAAGTGGATGG + Intergenic
959870133 3:111317441-111317463 ATATAAATGGGAAAAGATGAAGG + Intronic
960034761 3:113091249-113091271 ATTTCAATGGGAGTTTTGGAGGG + Intergenic
960626140 3:119684091-119684113 GTTTCATTGGGAAAAGAGAAAGG - Intergenic
961175664 3:124833064-124833086 ATTTCATTGCAAACAGTGGATGG - Intronic
961925913 3:130480448-130480470 AATTCTATGGGGAAAGTGGAAGG + Intronic
962452400 3:135531272-135531294 ATATCAGTGGGAAAGGTGAAAGG - Intergenic
962838598 3:139213198-139213220 ATTGCAATGGGAAGAGGAGAAGG - Intronic
963074301 3:141332226-141332248 TTCTCAATGGGAAAATAGGAAGG - Intronic
963124120 3:141799127-141799149 AATTCACTGGGATAAGGGGAAGG + Intronic
963287857 3:143453827-143453849 ATTTCAATGTGAAATTTGGAGGG - Intronic
963807300 3:149736484-149736506 ACTTCAATGGAAAAAGAGTAAGG + Intronic
965837710 3:172869543-172869565 ATTTCACTGGGAAAATGGAATGG + Intergenic
966169647 3:177064334-177064356 ACTGCAAGGGGAAATGTGGATGG - Intronic
966358059 3:179103368-179103390 ATGTTAATGGTAGAAGTGGATGG + Intergenic
967713072 3:192731606-192731628 ATGTCAAAGAGGAAAGTGGACGG + Intronic
969313742 4:6369496-6369518 TTTTAAATGGGAAAAGTAAAGGG + Intronic
970383746 4:15535566-15535588 ATAACAATGAGAAAAGTGAATGG + Intronic
970430744 4:15986808-15986830 GTCTCACTGAGAAAAGTGGAAGG + Intronic
970768080 4:19575609-19575631 ATTGAAAAGGGAAAAGGGGAAGG + Intergenic
970940836 4:21631506-21631528 ATTCCAGTTGGAAAGGTGGATGG + Intronic
973032783 4:45364746-45364768 ATTTAAGTGGTAAAAGAGGAGGG + Intergenic
973367934 4:49222543-49222565 ATTTTAATGGGAAATGTTAAAGG - Intergenic
974070409 4:57118315-57118337 ATTTCAATGGCTAAAGAGGTAGG - Intergenic
974651235 4:64756017-64756039 ATTTCAACGTGAGAATTGGAGGG - Intergenic
974837059 4:67263965-67263987 ATTTCAATGAGAAATGGGGATGG + Intergenic
975407043 4:74001613-74001635 ATCTCAAAGGCAAGAGTGGAAGG - Intergenic
975473597 4:74796621-74796643 ATTACATTTGGAAGAGTGGAAGG + Intergenic
976532148 4:86167909-86167931 ATTCAAATAGGAAAAGAGGAAGG + Intronic
976886681 4:89993482-89993504 CTTTTAATGGAAAAAATGGAAGG + Intergenic
977106983 4:92898803-92898825 GTTTCAATGGGAAATGTGCATGG + Intronic
977640065 4:99347322-99347344 AATTCAAGGGAAAAAGAGGAAGG - Intronic
979089856 4:116468682-116468704 ATTTGTTTAGGAAAAGTGGAGGG - Intergenic
979580879 4:122358386-122358408 ATTTCAATGGGAAAAGGGGGTGG + Intronic
980465064 4:133164486-133164508 ATTTCAAGGCAAAAAGTGAAGGG + Intronic
980842655 4:138284297-138284319 ATTTTACTGGGAGAATTGGAGGG + Intergenic
980843149 4:138291191-138291213 CTTTCAATGGGAGAAGGGGGAGG - Intergenic
980969095 4:139552628-139552650 CTTACAAGGAGAAAAGTGGAGGG - Intronic
981258553 4:142692133-142692155 ACTTCAGAGGGCAAAGTGGAAGG - Intronic
981849123 4:149207399-149207421 ATTTAAATGGGTAAATTGCATGG + Intergenic
982330559 4:154177630-154177652 TTCTCAAGGGGAGAAGTGGATGG - Intergenic
983768126 4:171512501-171512523 ATTTCATTGTGAAAGGAGGAAGG - Intergenic
984381541 4:178998966-178998988 AGGACAGTGGGAAAAGTGGATGG - Intergenic
985277634 4:188253855-188253877 ATTTCAATGAGAAAAGTAATTGG - Intergenic
1202765011 4_GL000008v2_random:142035-142057 ATTTTAATGGGAAATGTTAAAGG - Intergenic
986357919 5:6947055-6947077 ATTTCAATGGTGAAAGATGATGG - Intergenic
986537494 5:8805919-8805941 ATATCCATGGGTAAAGTGGGAGG - Intergenic
986710423 5:10484606-10484628 ATTTCCATGGGAAGAGGTGAGGG + Intergenic
987187775 5:15443251-15443273 ACTTCTCTGGGAACAGTGGAAGG + Intergenic
987191997 5:15487937-15487959 ATTTCAACGTGAGATGTGGAGGG + Intergenic
987689070 5:21244080-21244102 ATTTCAATATAAAAATTGGAGGG - Intergenic
988209251 5:28181807-28181829 ATCCAAATGGGAAAAGAGGAAGG - Intergenic
988463572 5:31465601-31465623 ATTTCAATGTGAAATTTGGAGGG - Intronic
990052223 5:51517834-51517856 TTTTCAATGGACAAAGTGGTTGG + Intergenic
990283737 5:54278806-54278828 ACCTCAGTGGGAAAGGTGGACGG + Intronic
990402505 5:55453101-55453123 ATTTAAATTTGAAAAGTGTAAGG - Intronic
992363032 5:76062203-76062225 ATTTCAATGTGAACTTTGGAGGG - Intergenic
993025316 5:82638646-82638668 ATTGCAATGGGATAAGGGAAAGG - Intergenic
993754128 5:91706320-91706342 ATATAAATGGGTAAAGTTGATGG + Intergenic
994136726 5:96296303-96296325 TTTTCAGTGGGAAGAATGGAAGG - Intergenic
995076286 5:107988341-107988363 ATTTTAATTGCAAAAGTGGAGGG - Intronic
995987877 5:118202260-118202282 ATTTCAATGGGACTACAGGAAGG - Intergenic
996410582 5:123154712-123154734 ATTTGAAAAGGAAAATTGGAAGG + Intronic
997492308 5:134287747-134287769 ATTTCAAAGGCAAAATTAGAAGG - Intronic
998873682 5:146577514-146577536 ATGTAAATGGAAAAATTGGATGG + Intergenic
998947423 5:147354525-147354547 ATTACAAGGGTAAAAGTGGAAGG - Intronic
999493342 5:152073006-152073028 TGTGCAATGGGGAAAGTGGAGGG + Intergenic
999901126 5:156088048-156088070 AGTTCTATGGGAAAGGGGGATGG - Intronic
999938368 5:156513514-156513536 TTTTCAATAGGAAAAGCAGAAGG - Intronic
1000671535 5:164068996-164069018 ATTTAAATGGAAGAAGTGTAGGG + Intergenic
1000874573 5:166620109-166620131 ATTTGGATGGGGAAAGTGAAGGG + Intergenic
1001851479 5:174970716-174970738 GTATGAATGGGAATAGTGGATGG - Intergenic
1003147450 6:3520699-3520721 ATTCCCATGGGGAAACTGGAGGG + Intergenic
1003788936 6:9520670-9520692 ATTTCAATGTGAGATTTGGAGGG + Intergenic
1005631716 6:27714329-27714351 CTTTAAAGGGGAAAAGTGCATGG - Intergenic
1005793988 6:29337766-29337788 ATTTCAATAGGCAGAGTGAATGG - Intergenic
1007824879 6:44592894-44592916 AGCTCTAAGGGAAAAGTGGAAGG + Intergenic
1008042545 6:46817058-46817080 TTTTCTAGGGGAAAAATGGAAGG + Intronic
1008513054 6:52295447-52295469 ATTTCAATAGGAGATTTGGAGGG - Intergenic
1008564785 6:52756472-52756494 AATTCATTGAGAAAAGTGCATGG + Intronic
1008569115 6:52797798-52797820 AATTCATTGAGAAAAGTGCATGG + Intronic
1008573577 6:52837772-52837794 AATTCATTGAGAAAAGTGCATGG + Intronic
1008821457 6:55636692-55636714 ATTGCAATGAGAAAAATGCATGG - Intergenic
1009863818 6:69370580-69370602 ATGTCAATGTGAAATATGGAAGG - Intronic
1012054051 6:94382450-94382472 ATTTCCATGGGAAAACTCTATGG + Intergenic
1012059984 6:94466060-94466082 GCTTCAATGGAAAAAGTTGATGG - Intergenic
1012303972 6:97627149-97627171 ATTTTAATTGGAAAAAGGGAAGG + Intergenic
1013919313 6:115381994-115382016 AGTTCATTGATAAAAGTGGAGGG + Intergenic
1013924588 6:115455025-115455047 ATTTAAATGCAAAAAGTAGATGG + Intergenic
1013932974 6:115557092-115557114 ATTACAATGGGACATTTGGAGGG + Intergenic
1014105396 6:117555109-117555131 ATTTCCATAGGAAAAATTGAAGG - Intronic
1014737425 6:125110902-125110924 ATTTCAACAGGATATGTGGAGGG - Intergenic
1015265097 6:131283689-131283711 ATTTTAAAGGGTAAAGTTGAAGG - Intergenic
1015627335 6:135193488-135193510 GTTTCTATGGGAAAAATTGATGG - Intronic
1016473123 6:144396620-144396642 ATTTAAATGGGTAAATTGTATGG + Intronic
1016580897 6:145628586-145628608 ATTTCAAAGGGAAAGGAAGAGGG + Intronic
1017229023 6:152052302-152052324 ATTTCAATGTGAGATTTGGAGGG + Intronic
1017455628 6:154598584-154598606 ATTTCAATAGGAAGAGAGGAGGG - Intergenic
1017718676 6:157229772-157229794 ATCCCAAGGGGACAAGTGGATGG + Intergenic
1018304881 6:162444552-162444574 ATTTCAATAGGAAGAGGAGAAGG - Intronic
1018670066 6:166169746-166169768 AGATAAAAGGGAAAAGTGGAGGG + Intergenic
1022243548 7:28535293-28535315 ATTTCTTTAGGAAAAGTGAAAGG + Intronic
1023165505 7:37339363-37339385 AATACAATGTGATAAGTGGAGGG + Intronic
1024107394 7:46107363-46107385 ATTTCCAAGGGCAGAGTGGACGG + Intergenic
1024173522 7:46814221-46814243 AAGTCATTGGGAAAAGAGGATGG + Intergenic
1025080801 7:55980802-55980824 AATTCAATGGGCCAAGGGGATGG - Intronic
1025234380 7:57224081-57224103 ATTTCAACATGAAATGTGGAGGG - Intergenic
1026219637 7:68382527-68382549 ATTTCAATGAGAGATTTGGAGGG - Intergenic
1026465588 7:70650958-70650980 ATTTCAATGGACAGAGAGGAAGG + Intronic
1026642841 7:72141955-72141977 ATTTCAACCTGAAATGTGGAGGG - Intronic
1027185320 7:75967651-75967673 TTTTTAATGGGAAACGGGGAGGG + Intronic
1027515908 7:79141359-79141381 ATTTGAAAGGGAAAACTGGGAGG - Intronic
1027682285 7:81235890-81235912 GTTCCAATGGGGAAAGTGGAAGG - Intergenic
1027878250 7:83799608-83799630 ATTACAATGGAAAAGGTTGAGGG + Intergenic
1028877875 7:95843963-95843985 ACTGCAATGGGAAAATTTGAGGG + Intronic
1030609993 7:111678975-111678997 ATTTAAAGGGGAAAAGTGGGTGG + Intergenic
1031845461 7:126800395-126800417 ATTTAAATGGGAAAAATGGGGGG - Intronic
1032631598 7:133659037-133659059 ATATAAATGGGAAAAGGGGCTGG + Intronic
1032780419 7:135161365-135161387 ATTCAAATGGGAAAAGTGAGAGG + Intronic
1032871542 7:135991326-135991348 ATTTAAAGGCGAAAAGTGGCTGG + Intergenic
1033772118 7:144564263-144564285 ATTTCAATGGCAAATGGCGAAGG + Intronic
1033918803 7:146362316-146362338 ATTACATTGTGAAAAGTGCAAGG + Intronic
1034018224 7:147610236-147610258 ATTTAAGTGGAAAAAGTTGACGG - Intronic
1034574515 7:151985623-151985645 AGGACTATGGGAAAAGTGGATGG - Intronic
1037166531 8:15836676-15836698 ATTTAAATGGTGTAAGTGGAAGG - Intergenic
1037393703 8:18420450-18420472 ATTTCAATGTGAGATTTGGAGGG - Intergenic
1037674130 8:21039696-21039718 ATTTGAAAGGGAAAGATGGATGG - Intergenic
1038214553 8:25549847-25549869 TTTACTATGGGACAAGTGGAAGG - Intergenic
1038304922 8:26391288-26391310 ATGGCAATGGGAAAAATGGGGGG + Exonic
1038506641 8:28090533-28090555 ATTGCAATGGGAAGGGTAGAAGG - Intronic
1038529480 8:28306226-28306248 ATCCCAATGGCAAAAGAGGAGGG - Intergenic
1039135070 8:34312757-34312779 ATTCCAATTGGAACAGTGCAGGG - Intergenic
1039271296 8:35883584-35883606 ATTTCAATATGAAATTTGGAGGG - Intergenic
1039356240 8:36819830-36819852 ATTTAAATGGGAGAAGGGGCAGG - Intronic
1041751340 8:61264357-61264379 ATTGCAGTGGGAAAAATGGAAGG + Intronic
1041954476 8:63542304-63542326 TATTCAATGGGAAATGTGCAAGG + Intergenic
1042356421 8:67833468-67833490 ATTTCAATGGAATATGTGAAGGG - Intergenic
1042721981 8:71835556-71835578 ATTTCAATGTGAGATTTGGAGGG + Intronic
1042983487 8:74556656-74556678 CTTTCAATTGGAAGATTGGAGGG + Intergenic
1043209127 8:77488839-77488861 ATTTACATGTGAAAAGTGCATGG - Intergenic
1044256770 8:90072897-90072919 ATATCAAGGGGATGAGTGGAAGG + Intronic
1044330542 8:90915014-90915036 ATTTAAATGAGAAAAGAGTAAGG + Intronic
1045171763 8:99678266-99678288 ATTTCAAAGAAAAAAGTAGAAGG - Intronic
1045985413 8:108244602-108244624 ATTTTAATGGTAATGGTGGAAGG - Intronic
1048894759 8:138981279-138981301 ATTTCAATGTGAGGATTGGAAGG + Intergenic
1049870334 8:144970188-144970210 AATTCCATGGGAAATGAGGACGG - Intergenic
1052050667 9:23844992-23845014 ATTTCACTTGGAAAACTGGTAGG - Intergenic
1052490232 9:29157763-29157785 ATTTAAATTGGGAAAATGGAGGG - Intergenic
1052671848 9:31567979-31568001 ATTTCTAAGGGAAAAAAGGAAGG - Intergenic
1056132506 9:83600194-83600216 ATTTCCATGGGAAAGGAGGCTGG + Intergenic
1056700308 9:88899399-88899421 AATTCAATGGGAAAAGGATATGG - Intergenic
1058122755 9:101156757-101156779 ATGTCAATGGGAAGAGGAGAGGG + Intronic
1059639204 9:116200052-116200074 ATTTCAATGTGACATTTGGAGGG + Intronic
1059788287 9:117611148-117611170 CATACAATAGGAAAAGTGGAAGG + Intergenic
1060861480 9:126958196-126958218 ATTTCAAGGGGAATGGGGGAGGG + Intronic
1061605481 9:131706921-131706943 ATTTAAATGAGAAGAGTGGTAGG - Intronic
1062208516 9:135350305-135350327 ATCTCATTGGTAAATGTGGAAGG + Intergenic
1203489444 Un_GL000224v1:89544-89566 ATTTCAATGAGAGATTTGGACGG + Intergenic
1203502065 Un_KI270741v1:31432-31454 ATTTCAATGAGAGATTTGGACGG + Intergenic
1203545760 Un_KI270743v1:126924-126946 ATTTTAATGGGAAATGTTAAAGG - Intergenic
1185747101 X:2582569-2582591 ATTTTAATGGAGAATGTGGAGGG + Intergenic
1186225326 X:7393070-7393092 GTTTCTCTGGGAAAAGAGGAAGG - Intergenic
1187252150 X:17608244-17608266 ATTGCACTGGGAAAAGTTTAAGG + Intronic
1187377074 X:18764576-18764598 AGTGCCATGGGAAAGGTGGAAGG + Intronic
1188670841 X:32879912-32879934 ATTCAAATGGGAGAAGAGGAAGG - Intronic
1189081631 X:37979210-37979232 ATTTAAACGGGAAAAGTGGGCGG + Intronic
1189506881 X:41620195-41620217 TTTTAAAAGGGAATAGTGGAAGG + Intronic
1189532242 X:41897660-41897682 TTTTCAATGGGAAAATGGGAAGG - Intronic
1189903974 X:45738328-45738350 ATTTAAATGTGAAATGTGAAAGG + Intergenic
1190189713 X:48267315-48267337 ATGGCAATGGGAAAAGCAGATGG - Exonic
1190199319 X:48346534-48346556 ATGGCAATGGGAAAAGCAGATGG + Exonic
1190666088 X:52697003-52697025 ATGGCAATGGGAAAAGCAGATGG + Exonic
1190673330 X:52761407-52761429 ATGGCAATGGGAAAAGCAGATGG - Exonic
1191713258 X:64175221-64175243 ATTTCAATGGGCAAAAATGATGG + Intergenic
1192341248 X:70265345-70265367 TATTCAATGGTAAAAGAGGAAGG + Intergenic
1192377789 X:70581778-70581800 ATTTCAAAGAGAAAATTTGAGGG - Intronic
1193866249 X:86734062-86734084 AGTTCAGTGGGAAAAATGCATGG - Intronic
1193945678 X:87730440-87730462 ATTTAAATGGACAAAGTGAATGG + Intergenic
1194045607 X:88998046-88998068 ATTTACATGGTCAAAGTGGATGG + Intergenic
1194455636 X:94099459-94099481 ATTTTAATGGGAAAATCAGAGGG + Intergenic
1194461327 X:94172855-94172877 CCTTCAATTGGAAAAGTGGTTGG + Intergenic
1194679266 X:96831935-96831957 AATGCAATGTGATAAGTGGAGGG - Intronic
1196292543 X:113960314-113960336 ACCTCAATGGAAAAAGAGGAAGG + Intergenic
1197140308 X:123110485-123110507 ATTTTAATGGGAAATGTTGAGGG - Intergenic
1197260255 X:124309715-124309737 ATTTGAATGGAAAAAGTGCCAGG + Intronic
1197262506 X:124333604-124333626 ATTTCATTGGGAATGGTGGTGGG - Intronic
1197409877 X:126103629-126103651 ATTTGAAAGGGAAGAGTGGTAGG + Intergenic
1198861466 X:141075294-141075316 ATTTCAATGTGAAATTTGGAGGG - Intergenic
1198873344 X:141198342-141198364 ATGGAAATGGGAAAAGTGCAAGG + Intergenic
1198901226 X:141512089-141512111 ATTTCAATGTGAAATTTGGAGGG + Intergenic
1199049868 X:143224474-143224496 ATTTCAAAGAGAAAGGAGGAGGG + Intergenic
1200614629 Y:5364574-5364596 ATTTCAAGGAGAAAAGTGAAAGG + Intronic
1200717591 Y:6567349-6567371 ACCTTAATAGGAAAAGTGGAAGG + Intergenic
1201712771 Y:17010747-17010769 ACCAAAATGGGAAAAGTGGAAGG - Intergenic
1202053766 Y:20807792-20807814 ATTTCAATGTGAAATTTGGAGGG - Intergenic