ID: 932077873

View in Genome Browser
Species Human (GRCh38)
Location 2:68681990-68682012
Sequence CTGGAAATCTTGAGAAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932077873 Original CRISPR CTGGAAATCTTGAGAAAAAC GGG Intronic
904476138 1:30765813-30765835 CTGGAAAGCTTCAGACAGACAGG - Intergenic
906167177 1:43695228-43695250 CTGAAAATGTTGAGAACAAATGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907914394 1:58855344-58855366 TTTGAAATCTTGGGAAAAAGAGG - Intergenic
907936272 1:59045117-59045139 CTGGAAAGAATGAGAAAAAGAGG - Intergenic
909212191 1:72838120-72838142 CTAGAAATAATGAGAAACACTGG + Intergenic
909753042 1:79188493-79188515 GTGGAAAGCTTAAGAAAAACAGG + Intergenic
909830328 1:80180946-80180968 TTGAAAATTTTGTGAAAAACTGG - Intergenic
909872505 1:80760344-80760366 CTGAAAATGTTAAGAAAAGCAGG - Intergenic
910362608 1:86429149-86429171 CTGGATATCAGGAGAATAACTGG + Intronic
911786722 1:101959443-101959465 CTGTGAATCTTGATAATAACAGG + Intronic
913014733 1:114721512-114721534 GTGGAAAACATGAGAAAAACAGG + Intronic
914700876 1:150132369-150132391 CTGGAAATAATGAGGTAAACAGG - Intronic
915057396 1:153147191-153147213 CTGCAATTCTGGAGGAAAACAGG + Intergenic
915174155 1:154000918-154000940 CAGGAAATATTGATGAAAACAGG + Exonic
915981550 1:160423517-160423539 CAGGAAACCTAGAGAAAAAAGGG - Intronic
916704275 1:167332008-167332030 CTGGTAATCTTGATAAAAGATGG - Intronic
917264426 1:173205407-173205429 CAGGAGATGTTGAGAAAAAGAGG - Intronic
917390075 1:174526588-174526610 CTGGAAAACTTAAGAGAAAATGG - Intronic
918769363 1:188534635-188534657 ATGTAAATCTAAAGAAAAACAGG - Intergenic
919201996 1:194367055-194367077 CAGGAAAGCTTGAGGAAGACAGG - Intergenic
919897200 1:202016371-202016393 CTAGACATCTTGAGAACATCAGG - Intronic
920284062 1:204867065-204867087 CTGGACATTTGGAGAAAAACAGG + Intronic
920775391 1:208931932-208931954 CTGAAAATCTTGTGAAAATACGG + Intergenic
921513180 1:216057353-216057375 ATGTAAATCTTGAAAGAAACTGG - Intronic
921559450 1:216639717-216639739 ATGTAATTCTTGAGAAAAATAGG + Intronic
921802929 1:219422081-219422103 ATGGAAACCTTGGGAAAAAATGG - Intergenic
922311449 1:224395887-224395909 CTGGCAATATGTAGAAAAACTGG - Intronic
922486163 1:225974819-225974841 CTGGAAATTCAGAGAAAAAGTGG - Intergenic
924134040 1:240944624-240944646 GTGGAAATCATGGGAAAAAAAGG + Intronic
924164159 1:241264880-241264902 CTTGACATCTTGGAAAAAACAGG + Intronic
1063229871 10:4054468-4054490 CTGGAAATGTTGTGAATATCTGG - Intergenic
1064177503 10:13087600-13087622 ATGGAAGTCTGGGGAAAAACAGG + Intronic
1066624147 10:37389431-37389453 CTGGAGAGTTGGAGAAAAACTGG + Intergenic
1067264500 10:44726507-44726529 CTATAAAACTTGATAAAAACAGG - Intergenic
1069024262 10:63522186-63522208 CTGCAAATCTTGGGAAAACTAGG - Intronic
1071837538 10:89433909-89433931 CTCTAAATTTTGAGGAAAACCGG + Intronic
1071919135 10:90329620-90329642 ATGAAAATCTTGAGACTAACTGG - Intergenic
1072272506 10:93790481-93790503 CTGGACCTCATGAGAAAAAAGGG - Intronic
1073862358 10:107761733-107761755 CTGGAAATGTGAATAAAAACAGG - Intergenic
1074179091 10:111042244-111042266 CTAGAAATAATGAGAAAAATTGG + Intergenic
1074525067 10:114255970-114255992 TGGCAAATCTTGAAAAAAACTGG + Intronic
1074862817 10:117525152-117525174 CTGGATCTCTTGGGTAAAACTGG - Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1078429865 11:11280585-11280607 CTGGAAATGCTGGGAAAAACTGG - Intronic
1079460209 11:20671724-20671746 CTGGGAATCTAGATAGAAACTGG + Intronic
1080081473 11:28223190-28223212 ATGGAAAACTTGAAAAAGACAGG + Intronic
1081056963 11:38421677-38421699 CTGGAAATCTTGAGACTACGTGG + Intergenic
1084409916 11:69000953-69000975 CTGGAGAACTTGAAAACAACAGG - Intergenic
1086657685 11:89380261-89380283 CAGAAAATGTGGAGAAAAACAGG + Intronic
1087201023 11:95344771-95344793 CTGCCCATCTTGAGAACAACAGG - Intergenic
1087485818 11:98758770-98758792 CTGGATAGCTTGAGTAAAGCTGG - Intergenic
1088335343 11:108697783-108697805 CTGGACATTTTTATAAAAACTGG - Intronic
1088432196 11:109770926-109770948 CTGGAAACATTAAGAAAGACAGG + Intergenic
1090201502 11:124861189-124861211 CTGGAAATCTGGAGACAACTGGG - Intergenic
1090314965 11:125778127-125778149 TTGGTAATCTTGAGAAAGATAGG + Intronic
1090978517 11:131695969-131695991 CTGGAGTGCATGAGAAAAACTGG + Intronic
1093046274 12:14448767-14448789 CTGGAACTCTTGAGCACTACTGG - Intronic
1093398433 12:18712534-18712556 CAGGAAAGTTTGAGAAATACTGG - Intronic
1093593087 12:20930030-20930052 CTGGAAATCTAGAGAGAGATGGG - Intergenic
1093649731 12:21629127-21629149 CTTGAAATCTTCAGAAATTCTGG - Intergenic
1093750777 12:22797378-22797400 CTCTAAATGTTAAGAAAAACTGG + Intergenic
1093924724 12:24898361-24898383 CAAGAAATATTGAGAAAAACAGG + Intronic
1093958293 12:25247725-25247747 CTGGAAAACTTGTGAAAGAATGG - Intronic
1094278853 12:28711489-28711511 CTGGAATTCTTAAGAGAACCTGG + Intergenic
1095172683 12:39054632-39054654 CTGGGCACCTTGAAAAAAACAGG + Intergenic
1096313421 12:50542603-50542625 CTAGAAACCTTGACAACAACAGG + Intronic
1096824812 12:54267188-54267210 AAGTAAATCTTGAGAAAAATGGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101301980 12:103492617-103492639 CTGGAAATACTGAGATAATCTGG - Intronic
1103059487 12:117847370-117847392 CTGGCAGTCAGGAGAAAAACAGG - Intronic
1104378570 12:128286883-128286905 CTGGAAAACTTGAGAGAGAGGGG + Intronic
1105829122 13:24148806-24148828 CTGGAAAGCTTGAGGAAGGCAGG + Intronic
1106435262 13:29717922-29717944 CTTAAAAACTTGAGAAAACCTGG + Intergenic
1107117055 13:36758281-36758303 TAGGAAAGCTTGAGAAGAACAGG - Intergenic
1107130578 13:36890485-36890507 CTGGGAACATTGAAAAAAACTGG - Intronic
1107166894 13:37292870-37292892 AGGGAAATTTTGAGAAAAAAGGG + Intergenic
1107543010 13:41410782-41410804 CTGGAAATGTGGAGAGAAAGAGG + Intergenic
1107952751 13:45479001-45479023 TTGCAAACCATGAGAAAAACTGG - Exonic
1108997970 13:56759409-56759431 CTGCAAATCTTCAGCATAACAGG + Intergenic
1109073193 13:57795992-57796014 CTGGCAATGTTTAAAAAAACAGG - Intergenic
1110170029 13:72489275-72489297 CTTGAAATCTTGTCTAAAACTGG - Intergenic
1110311095 13:74050056-74050078 CTGCAAAACTTGACAAAAACAGG + Intronic
1110335102 13:74319920-74319942 CTGGAAATCTTGCGTACTACTGG - Intergenic
1111413287 13:87905489-87905511 CTAGAAAACATGAGAAAATCTGG - Intergenic
1111526574 13:89478951-89478973 CTTGAAAACTTGAGATAAAGAGG + Intergenic
1111599200 13:90449891-90449913 CTAAAAATATTGGGAAAAACAGG - Intergenic
1111889387 13:94062718-94062740 CTGTAAATCATATGAAAAACTGG + Intronic
1114957969 14:27847060-27847082 CAGAAAATCTTGAGAGAATCTGG - Intergenic
1116766398 14:49075743-49075765 CTAGAATTTGTGAGAAAAACAGG + Intergenic
1116825936 14:49673420-49673442 CAGGAAATGATGAGAAAATCAGG - Intronic
1117061752 14:51971052-51971074 CTGGAAGTCATAAGAAAAGCCGG + Intronic
1117275635 14:54190522-54190544 ATCTAAATCTTGGGAAAAACTGG - Intergenic
1119470556 14:74895350-74895372 ATTGAAATCTTGAAGAAAACAGG - Intronic
1120465367 14:84849650-84849672 GTGGAAAACTTGAGAAATAGAGG - Intergenic
1121188369 14:91998006-91998028 CTGGAAAACTTGTTTAAAACGGG - Intronic
1121688229 14:95855632-95855654 CTGGAGATACTGAGAGAAACAGG - Intergenic
1121696177 14:95914139-95914161 CTGGAAACCTAGTCAAAAACTGG + Intergenic
1124142767 15:27091956-27091978 CTGAAAAACTTGACAAAAACTGG - Intronic
1124604191 15:31158861-31158883 CTGGATATCTGGAGAACAAAGGG - Intronic
1126080661 15:44957872-44957894 ACGGAAGTCATGAGAAAAACTGG - Intronic
1130163092 15:81421866-81421888 CTGGAAAAATTGATAGAAACTGG + Intergenic
1131980512 15:97990231-97990253 GTGCATATATTGAGAAAAACAGG + Intergenic
1133171084 16:3982966-3982988 CTGGAAATCTGGGGACAAGCTGG + Intronic
1133828719 16:9302222-9302244 CTGGGAATCTTTGGAAAAACGGG + Intergenic
1134681942 16:16132391-16132413 CTGGAACTCTTGAGCTCAACCGG + Intronic
1137639458 16:50015549-50015571 CAAGAAATCTTTAGCAAAACAGG + Intergenic
1138321658 16:56119253-56119275 CTTAAATTCTTGAGATAAACCGG - Intergenic
1138385133 16:56631403-56631425 CTGGAAATCTTCTAAACAACAGG - Intergenic
1138977696 16:62227684-62227706 CTAGAAAACTGGAGAAAAATTGG + Intergenic
1144321454 17:14125265-14125287 CTGGCAATGTTGTGCAAAACAGG - Intronic
1147001363 17:37364849-37364871 CTAGAAAGATTCAGAAAAACAGG - Intronic
1150598465 17:66628211-66628233 GTGGAAATCTTGAGCCAAAGAGG - Intronic
1150807727 17:68332353-68332375 CTGGGCATCTTGAAAAAAACAGG - Intronic
1150825811 17:68473852-68473874 CTGGAAAGATGGAGAGAAACTGG + Intergenic
1151856179 17:76723792-76723814 CTGGAAATCTTACAAAAACCAGG - Exonic
1153157900 18:2169666-2169688 CTGGAAATCCTAAGGAAAATGGG - Intergenic
1155643895 18:28054062-28054084 TTGAAAGTCTTGACAAAAACAGG + Intronic
1156839102 18:41590303-41590325 CTGGAAATGTTTAGAAGATCTGG + Intergenic
1157448771 18:47769432-47769454 CTGTAAATGATGAGAAAAAATGG - Intergenic
1159586161 18:70285650-70285672 TTGGTTATCTTGAGCAAAACAGG + Intergenic
1160482062 18:79250593-79250615 CTTGAATTATTGAGAAAAATAGG - Intronic
1161209726 19:3060144-3060166 CTGGGAATCTGGAGAAAGTCAGG - Intronic
1167980907 19:53274153-53274175 GTGGAAATCATGAGAAGAAAAGG + Intergenic
925684430 2:6456989-6457011 GTGGAAATCTAGAGGAAAGCCGG + Intergenic
926295161 2:11563831-11563853 CTGGAAATATGGAGATAAATGGG + Intronic
926899082 2:17729715-17729737 CTTAAAATCTAGAGAAAAGCAGG - Intronic
927099057 2:19773554-19773576 CAGGAACTCTTCAGAAAAGCAGG - Intergenic
927343000 2:22003785-22003807 CTGGAATTCTATAGGAAAACAGG - Intergenic
928591186 2:32817054-32817076 CAGGGAATTTTGGGAAAAACAGG - Intronic
928832612 2:35506064-35506086 CAGGACAGCTTGAAAAAAACTGG - Intergenic
930826595 2:55701772-55701794 CCGGAAATCTTAGGAAAGACGGG - Intergenic
932072183 2:68631813-68631835 CTGGGAATATTGAGACAAAAAGG - Intergenic
932077873 2:68681990-68682012 CTGGAAATCTTGAGAAAAACGGG + Intronic
932914876 2:75846168-75846190 CTGGAAACCTTCAGCAAATCTGG - Intergenic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933359803 2:81267092-81267114 CTGGAAATCTAAAGAAATTCAGG + Intergenic
933637510 2:84723897-84723919 CTGGAAGTCTTTAGCAAAATTGG - Intronic
934112295 2:88755278-88755300 CTGGAAAAGTTAAGAGAAACAGG + Intergenic
935511251 2:103977729-103977751 CTGGAGATGTTGATAAAAAAAGG - Intergenic
935847841 2:107186211-107186233 AAGGAAATCTTAAGAAAAAAAGG + Intergenic
935850710 2:107216047-107216069 TTGGAAGTCATGACAAAAACTGG + Intergenic
936935485 2:117835439-117835461 CTGGACATTTTGACAAAAAGAGG - Intergenic
938953528 2:136278574-136278596 CAGGAAATCTTGACAAATAAGGG + Intergenic
939028659 2:137044265-137044287 CTGGATATCTTCAGAAAAATTGG - Intronic
939440048 2:142236020-142236042 CTGGAAAATTTCAGAAAAAATGG + Intergenic
940188720 2:151015501-151015523 CTGGTAAAATTGAGAAATACTGG - Intronic
941531515 2:166676561-166676583 TTGGAAATCGTGATAGAAACTGG - Intergenic
941706058 2:168658966-168658988 CTGGATATCGTGAGAATATCAGG + Intronic
943581069 2:189684146-189684168 ATAGAAATATTGAGAAAAAATGG + Intronic
943987326 2:194639610-194639632 CTGGTAATATTCAGATAAACAGG + Intergenic
944016863 2:195051075-195051097 TTGGAAAGCTTGAGAAAGAGAGG - Intergenic
944337628 2:198555818-198555840 ATGAAAACCTTGAGAAAAAATGG - Intronic
944487995 2:200226944-200226966 CTGGAAATTTGGAGAAATAAAGG - Intergenic
944649710 2:201817262-201817284 CTGGTAAGCTTGAGAAGAAAAGG - Intronic
944740204 2:202604782-202604804 CTGAAAAATTTGAGAAAAACAGG + Intergenic
945151773 2:206799245-206799267 CAGGAAAGCTTGAGTAACACTGG - Intergenic
945573669 2:211503418-211503440 CTGGCAGTCTTGGGAGAAACTGG - Intronic
945589717 2:211715199-211715221 CTGGAAAATTTGAGAAGAAAGGG + Intronic
945918570 2:215731031-215731053 CTAGAAATGCTGAGTAAAACAGG + Intergenic
946964573 2:225024112-225024134 CTCGAAATGTTGAAAAATACAGG - Intronic
1169022460 20:2340159-2340181 CTTGAACTCCTGAGAAGAACAGG + Intronic
1169943541 20:10964090-10964112 CAGGAAAACTTCAGAAAAAAAGG + Intergenic
1170867278 20:20169852-20169874 CTGTAAATCATGAGACAAAATGG + Intronic
1172122316 20:32605760-32605782 CCGGACAGCTGGAGAAAAACGGG - Intronic
1172188269 20:33045271-33045293 CTGGGAACCTTGAAAAGAACAGG + Intergenic
1174910292 20:54600786-54600808 CTGGAAAACTTGAGCTAGACAGG - Intronic
1175183325 20:57163579-57163601 ATGGAAATTTTGAGAATAAATGG + Intergenic
1176934817 21:14854417-14854439 ATGAAAATCTTGAGAAAAGGTGG + Intergenic
1177957136 21:27612802-27612824 ATGAAAATCTTGAGAAATACTGG + Intergenic
1178177607 21:30121749-30121771 CTAGAAATCTTTTGAAACACTGG + Intergenic
1181340068 22:22171705-22171727 CTGGACCTGTTGAGAAAAACAGG - Intergenic
1182976990 22:34632257-34632279 CAGAAAATCTAGAGAAAAATGGG + Intergenic
1184697216 22:46146754-46146776 CTGTAGATCTTGAGAAGAACAGG - Intergenic
1184952844 22:47857088-47857110 GTGGATCTCTTGAGAAAAGCTGG - Intergenic
949168353 3:967849-967871 CTGGGAATATTGACAAAAACTGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
949975420 3:9453535-9453557 CTGAAAAACTTGAGGAAATCTGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951072038 3:18340583-18340605 CTGTAAATCTTGAGTAACATGGG + Intronic
951181444 3:19663787-19663809 TTGGAAATGTAGAGAAATACTGG - Intergenic
952266435 3:31791173-31791195 AGCCAAATCTTGAGAAAAACAGG - Intronic
952298014 3:32078069-32078091 CTGGAAATCCACAGAAAGACTGG + Intergenic
956561537 3:70582060-70582082 CTGGAAGTTTTGAGGGAAACTGG - Intergenic
959394615 3:105821672-105821694 CGGGCAATCTTGAGAAAGCCAGG - Intronic
959596254 3:108131950-108131972 CTGGAAGTGATGAGAAAAAGAGG - Intergenic
960431215 3:117571023-117571045 GTGGAAATATTGATAAAAATTGG - Intergenic
962493049 3:135911954-135911976 CAGGGATCCTTGAGAAAAACAGG - Intergenic
963372301 3:144416170-144416192 CATGATATCTTGAGTAAAACAGG + Intergenic
964748718 3:160035448-160035470 CTGGGAACCTGGAGAAAAAGTGG + Intergenic
964851068 3:161096837-161096859 CTGGAGAACTTGAAAAATACTGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965750862 3:171973710-171973732 GTGGAGATCTTGAAACAAACAGG - Intergenic
966041474 3:175494917-175494939 CTGCAAATCTTGAAAAAATAAGG - Intronic
966845896 3:184129501-184129523 CTGGACATGCTAAGAAAAACAGG + Intergenic
967010481 3:185428483-185428505 CTCCAAAACCTGAGAAAAACAGG - Exonic
967344078 3:188434003-188434025 CTGGAAACCATGAGAAACATGGG - Intronic
967719177 3:192797275-192797297 CTGAGAGTTTTGAGAAAAACTGG - Exonic
968887483 4:3342162-3342184 CTCAAAATCTTGACATAAACAGG + Intronic
969163624 4:5283735-5283757 CTGGCAATCTTTAGAAATAATGG + Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
969961623 4:10950223-10950245 CTGGATTTATTTAGAAAAACTGG + Intergenic
970346914 4:15161228-15161250 CTTGAAATCTGGAAGAAAACTGG + Intergenic
970647820 4:18143139-18143161 CTTGAAGTCTATAGAAAAACAGG - Intergenic
971568806 4:28183545-28183567 CTGAAACTCTTCAGAAAAAATGG - Intergenic
972738949 4:41873225-41873247 AAGAAAATGTTGAGAAAAACAGG + Intergenic
975462673 4:74672620-74672642 CTGGAAAGTTTGAGAAAGAGAGG - Intergenic
976928414 4:90531726-90531748 CTGAAAATTCTGTGAAAAACTGG + Intronic
977331680 4:95644419-95644441 CTGGTAATATTGAGACAACCAGG + Intergenic
978074154 4:104508231-104508253 CTGGAAATCTTGAAAAGAGATGG - Intergenic
978291822 4:107151068-107151090 CTGTAAATCTTTAGGAAAATTGG - Intronic
978811077 4:112850474-112850496 CAGGAAATGTTAAAAAAAACTGG - Intronic
979582263 4:122374678-122374700 CTTGAAATCTGGAGAAAGATAGG + Intergenic
979698906 4:123644986-123645008 CTGAAATTCTTGAGAATGACTGG - Intergenic
980073316 4:128265977-128265999 CTGGGCACCTTGAAAAAAACAGG - Intergenic
980914375 4:139020726-139020748 CTGGAAAGCTTGAGAAGCTCTGG + Intronic
981789070 4:148515719-148515741 CTTGAAATTTTGAAAAAAAATGG + Intergenic
983346140 4:166527171-166527193 CTGGAAAAACTGAGAAAAACTGG + Intergenic
983351268 4:166593196-166593218 CTGGAAATTTTAATAAAAATTGG + Intergenic
983463318 4:168054639-168054661 CTGCAAATTTTGAGAACCACTGG + Intergenic
983748158 4:171227977-171227999 CTGGAGTTCTTGAAAAAATCAGG - Intergenic
984334427 4:178370778-178370800 TTGGAAATTTTGAAAAGAACTGG + Intergenic
985546827 5:514159-514181 CTTCAGATCTTGAGAAAACCAGG + Intronic
986092457 5:4523601-4523623 CAGGCATCCTTGAGAAAAACAGG + Intergenic
986671621 5:10147679-10147701 CTGGGAACCTTGAGAAATCCTGG - Intergenic
988026263 5:25694367-25694389 GTGGAAATTCTGTGAAAAACAGG + Intergenic
989013204 5:36897865-36897887 CTGGAAAGCTTGAGTCATACAGG + Intronic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990854669 5:60250905-60250927 CTGAAAATCTTCAGTAAGACAGG + Intronic
993425266 5:87755828-87755850 CTGGATATTTTTAGGAAAACAGG + Intergenic
994172925 5:96678137-96678159 CTGGTAATTTTGAGAAGAAAAGG - Intronic
995634830 5:114175555-114175577 CTGAAGATCCTGAAAAAAACAGG + Intergenic
995783826 5:115807095-115807117 ATGGAAATCAGGTGAAAAACAGG + Intronic
996875576 5:128236939-128236961 ATTTAAATTTTGAGAAAAACAGG - Intergenic
998870367 5:146545445-146545467 CTAGATATCTTGAGAAGAATGGG - Intergenic
999689182 5:154131394-154131416 CGGGAAATCCTGAGCAAAACAGG + Intronic
999878749 5:155837550-155837572 GTGTAAATCTGGAGAAACACAGG - Intergenic
1001539131 5:172524884-172524906 CTGAGAATCTTGAGCAAGACAGG - Intergenic
1003527099 6:6907422-6907444 ATGGAAATCTGGAAAACAACAGG - Intergenic
1004454181 6:15776262-15776284 TTGGAACTCTTGAGAAACAGTGG - Intergenic
1004708244 6:18144684-18144706 CTGGTAATTTTGAGGAAAAGAGG + Intronic
1005985441 6:30870989-30871011 AAGGAACTCTTGAGACAAACAGG - Intergenic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1007179341 6:39917269-39917291 CAAGAAATGTTGAGCAAAACAGG + Intronic
1008538732 6:52528122-52528144 CTGGAAAGCTTTAGAAAAGCTGG - Intronic
1009989269 6:70821078-70821100 CAGGACATCTTGAGAAAATGGGG - Intronic
1010089142 6:71959203-71959225 CTAGAAAGTTAGAGAAAAACTGG - Intronic
1010734196 6:79424681-79424703 CTGGAAGTCTGGAACAAAACAGG + Intergenic
1012347671 6:98211383-98211405 CTGTAAAACTTGAAGAAAACAGG + Intergenic
1015086348 6:129297391-129297413 ATTGAAATCTTGAGAAGTACTGG + Intronic
1016685859 6:146881380-146881402 CTGGAAAGAAGGAGAAAAACTGG + Intergenic
1016738662 6:147507326-147507348 CGGGCAATCTTCAGAAAAAAAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017072060 6:150584322-150584344 CTGAAAATGTTTTGAAAAACTGG - Intergenic
1017359660 6:153552855-153552877 CTGGAAAACTTGTGAAAACTCGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1019720892 7:2570019-2570041 CTAGAAACCCGGAGAAAAACAGG - Intronic
1020188804 7:5978622-5978644 CTGGAAATATTTAGAAAGAATGG - Exonic
1020294111 7:6746140-6746162 CTGGAAATATTTAGAAAGAATGG + Intergenic
1021250214 7:18316074-18316096 CTTAACATTTTGAGAAAAACTGG - Intronic
1022115854 7:27259905-27259927 ATGCAAATATTGAGAAAAACAGG + Intergenic
1022210125 7:28200555-28200577 CTAGAGTTCTTCAGAAAAACAGG + Intergenic
1022829700 7:34053350-34053372 ATGGAAATCATAAGAAACACTGG - Intronic
1024955675 7:54917149-54917171 CTGGAACTCTTGAGTATTACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027388756 7:77684115-77684137 CTGGAAATGTTGTGAATGACAGG - Intergenic
1027472210 7:78587474-78587496 CTGGAAATCTACAGACAAATAGG - Intronic
1028863112 7:95677209-95677231 CTGACAAACCTGAGAAAAACAGG - Intergenic
1030474292 7:110009658-110009680 CTAGAAATCTTGAAAAATACTGG - Intergenic
1031651230 7:124292498-124292520 CTGGGGATTTTGAGAAAAAGTGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032147851 7:129400276-129400298 CAGGAAATCCTGGGAAAAAAAGG - Exonic
1032971629 7:137170935-137170957 CTGGAATTCATTAGAAAAAACGG + Intergenic
1033828723 7:145225734-145225756 CTGGAAACCTAGAAAAGAACAGG - Intergenic
1034020756 7:147639754-147639776 CTAGACTTCTTGAGACAAACAGG - Intronic
1036009905 8:4709970-4709992 TTAGAAATTTTGATAAAAACTGG + Intronic
1036439757 8:8771237-8771259 TTGGAAAAATTGAGAAGAACTGG + Intergenic
1038898246 8:31812188-31812210 CTGGAATTTATTAGAAAAACAGG + Intronic
1040625697 8:49147289-49147311 ATGGAAATATTGAGAAATAGAGG - Intergenic
1040637551 8:49292890-49292912 CTGGAAAAATTGATATAAACAGG + Intergenic
1042363486 8:67909185-67909207 CTGGGAAATTTGAGACAAACAGG + Intergenic
1042482712 8:69322370-69322392 CTGGAGACCTAGAGAAAAGCTGG + Intergenic
1044266518 8:90188526-90188548 CTGAAATTCTTGGAAAAAACAGG + Intergenic
1046155315 8:110281627-110281649 CTGGAAATAATGAGTAACACTGG + Intergenic
1046315460 8:112495620-112495642 CTGGAAATTTTGAAAACACCTGG + Intronic
1046325489 8:112639177-112639199 CTTGAAATTTTCAGAAAACCAGG - Intronic
1046766712 8:118077226-118077248 CTGGAAGGCTTGAGAATACCTGG - Intronic
1047804316 8:128343507-128343529 CAGGAAATCTGGAGAGAAATAGG + Intergenic
1047882155 8:129206891-129206913 ATGGAATCCTGGAGAAAAACTGG + Intergenic
1048247164 8:132818718-132818740 TTGGAAATCTTGTGGAAAAGTGG - Intronic
1048689757 8:136948630-136948652 CTGGAAGTCTGGTCAAAAACAGG + Intergenic
1048966917 8:139621839-139621861 CTGGAATGCTGGAGAATAACAGG + Intronic
1050782532 9:9355651-9355673 CTGGATTTCATGAGAAAGACAGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056403528 9:86251841-86251863 CTGGAAATCTTGTTTAAAAGAGG - Intronic
1058225140 9:102350980-102351002 CAGGAAATCTTGGGAATTACAGG - Intergenic
1058597485 9:106630590-106630612 CTAAAAAGCTAGAGAAAAACAGG - Intergenic
1060656777 9:125377333-125377355 GTGGACATATTGAGAAAAATTGG - Intergenic
1186152367 X:6688944-6688966 CTAGAAATATTGAAAAAAATAGG + Intergenic
1186225976 X:7399603-7399625 ATGGAAATGGTGAGAAAAATGGG - Intergenic
1187662290 X:21562498-21562520 CTGAAAATGTTGATAAATACAGG + Intronic
1188829986 X:34884425-34884447 TTGTAAACCTAGAGAAAAACAGG + Intergenic
1189081333 X:37975846-37975868 CTGGAAATCCTGAAAACAACAGG - Intronic
1191274913 X:58532914-58532936 TGGGATATCTTCAGAAAAACTGG - Intergenic
1191565631 X:62524526-62524548 CTGGATATCTTCACAAAAACTGG - Intergenic
1191565861 X:62529094-62529116 CGGGATATCTTCACAAAAACTGG - Intergenic
1191566855 X:62548602-62548624 CGGGATATCTTCACAAAAACTGG + Intergenic
1192005879 X:67211846-67211868 CTGGATTTCCTGAGAAAAATCGG + Intergenic
1194557971 X:95385923-95385945 CTGGAAATCCAGAAGAAAACTGG + Intergenic
1194961862 X:100245156-100245178 CTAGGAATCTAGAGGAAAACTGG + Intergenic
1195515436 X:105770030-105770052 TTGGAAATCTAGAAAAACACTGG + Intergenic
1196321426 X:114344886-114344908 ATGGGTTTCTTGAGAAAAACAGG + Intergenic
1196632631 X:117961213-117961235 CTGGAAATCTTATTAAAAAGTGG - Intronic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1198671987 X:139091015-139091037 CTGGAAATATTGAGAGAACTGGG + Intronic
1198717165 X:139569945-139569967 ATAGAAATATTGAGAAAACCAGG + Intergenic
1199234650 X:145477060-145477082 TTGGAATTCATGACAAAAACTGG - Intergenic
1200297252 X:154932897-154932919 ATGGAACTCTTGAAAAAAAGAGG + Intronic
1202334112 Y:23788808-23788830 CTGGAAATTTTAATAAAAAATGG + Intergenic
1202536656 Y:25881251-25881273 CTGGAAATTTTAATAAAAAATGG - Intergenic