ID: 932078984

View in Genome Browser
Species Human (GRCh38)
Location 2:68694278-68694300
Sequence CAGGCTACGACTTCACAAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932078984 Original CRISPR CAGGCTACGACTTCACAAAG CGG (reversed) Intronic
906857840 1:49327595-49327617 AAGGCTATGTCTTCACATAGTGG + Intronic
908897545 1:68917511-68917533 CAAGCTAAGAGTGCACAAAGAGG - Intergenic
911303545 1:96205517-96205539 CAGGCACCGTCTTCACAAGGTGG - Intergenic
915582497 1:156823308-156823330 AAGGCTCCAACTCCACAAAGGGG + Intronic
916147627 1:161754588-161754610 CAGGCCACTTCTTCACAAGGCGG + Intronic
923917326 1:238523737-238523759 CAGGCACCTGCTTCACAAAGTGG + Intergenic
1065124329 10:22559720-22559742 CAGGCCAGGACTTCTCCAAGTGG + Intronic
1066327336 10:34375944-34375966 CAAGCTACGACTGCACACATGGG + Intronic
1067942432 10:50668094-50668116 CAGGCTTTGACTGCACAAAGAGG - Intergenic
1068352069 10:55861102-55861124 AAGGCAACTTCTTCACAAAGTGG - Intergenic
1068930637 10:62585520-62585542 CAGGCTATGACTTCAAGAATTGG + Intronic
1070863676 10:79693052-79693074 CAGGCTTTGACTGCACAAAGAGG - Intergenic
1072323988 10:94278011-94278033 TAGGCTGCGATTTCTCAAAGTGG - Intronic
1073915128 10:108394146-108394168 CAGGCTACTAGTTTACAATGAGG + Intergenic
1081964615 11:47161895-47161917 CAGGCTACGGCGTGACAAGGTGG - Exonic
1086485728 11:87299305-87299327 CAGGCTTCTTCTTCACAAGGTGG + Intronic
1098719979 12:73884087-73884109 CAGGCAACTTCTTCACAAAGTGG - Intergenic
1098806349 12:75024683-75024705 CAGACTAAGTCTTCAGAAAGTGG - Intergenic
1099801254 12:87459902-87459924 CAGGCAACTTCTTCACAAGGTGG + Intergenic
1099996850 12:89787510-89787532 CAGGCAACTTCTTCACAAGGTGG - Intergenic
1108155904 13:47584390-47584412 CAGGCTGTGGCTTCAGAAAGTGG - Intergenic
1108311632 13:49198006-49198028 CAGGCTACTACTTCACTGAAAGG - Exonic
1108860991 13:54858458-54858480 CAGGCAACTTCTTCACAAGGCGG - Intergenic
1110304369 13:73967972-73967994 CAGGCTACTACTTCTCAATATGG + Intronic
1111211264 13:85083121-85083143 CAGGCTCAGTCTTCACATAGTGG - Intergenic
1113185069 13:107678708-107678730 AAGGCAACGTCTTCACAACGGGG + Intronic
1122575071 14:102737000-102737022 CAGGCTCCCACTTCTCAGAGTGG + Intergenic
1123472494 15:20565498-20565520 CAGGCTAGCACTTCCCCAAGAGG - Intergenic
1123645510 15:22434855-22434877 CAGGCTAGCACTTCCCCAAGAGG + Intergenic
1123666762 15:22614422-22614444 CAGGCTAGCACTTCCCCAAGAGG + Intergenic
1123732799 15:23160489-23160511 CAGGCTAGCACTTCCCCAAGAGG - Intergenic
1123750933 15:23357869-23357891 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124283304 15:28381785-28381807 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124299395 15:28529828-28529850 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124320602 15:28708995-28709017 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124481891 15:30086354-30086376 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124488347 15:30138452-30138474 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124521701 15:30410847-30410869 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124536963 15:30555372-30555394 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124543437 15:30607426-30607448 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124755180 15:32399868-32399890 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124761688 15:32452219-32452241 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124776940 15:32596849-32596871 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1127100653 15:55561449-55561471 CAGGCACCTTCTTCACAAAGTGG + Intronic
1132784456 16:1647864-1647886 CAGGCTAAGACTTCCCAGATAGG - Intronic
1133697183 16:8275927-8275949 CAGGCAACCTCTTCACAAGGTGG + Intergenic
1134192256 16:12130749-12130771 CAGGCTACCACTTCACATTAAGG - Intronic
1138776935 16:59734565-59734587 CAGGCACCTTCTTCACAAAGTGG - Intronic
1146326737 17:31892924-31892946 CCCGCTTCGGCTTCACAAAGTGG - Intronic
1153156463 18:2155267-2155289 CAGGCTACCAATTCAAATAGTGG - Intergenic
1160479840 18:79228776-79228798 CCTGCCACGACTTCCCAAAGTGG - Intronic
1164087941 19:21921019-21921041 GAGGCTGTGACTCCACAAAGAGG + Intergenic
1164180972 19:22818459-22818481 GAGGCTGCAACTTCACCAAGGGG + Intergenic
1164234546 19:23320961-23320983 CAGGCTGCGACTTATCTAAGGGG + Intronic
1164302680 19:23975587-23975609 CAGGCTGCGACTTATCTAAGGGG - Intergenic
925460977 2:4062186-4062208 CAGTCTACTACTCCACAATGGGG + Intergenic
929812967 2:45207218-45207240 CAGGCTGCCACTTGGCAAAGTGG - Intergenic
932078984 2:68694278-68694300 CAGGCTACGACTTCACAAAGCGG - Intronic
932532717 2:72554544-72554566 CAGGCAACTTCTTCACAAGGTGG - Intronic
935888904 2:107654103-107654125 CAGGCACCTTCTTCACAAAGTGG - Intergenic
936697069 2:114963742-114963764 GAGGGTAAGACTTCACACAGAGG + Intronic
940811270 2:158245346-158245368 GAAGCTAAGAATTCACAAAGTGG + Intronic
943829804 2:192446208-192446230 CAGGCAACTTCTTCACAAGGTGG - Intergenic
948718205 2:239879869-239879891 CTGGCTTCGAGTTCACCAAGAGG - Intergenic
1172645369 20:36465817-36465839 CAGGCAACAACTTCTCAAAGTGG - Intronic
949539501 3:5020949-5020971 CAGGTAAGGACTTCAAAAAGAGG + Intergenic
955233027 3:57115624-57115646 CAGGCTGCGACTTCAGAGAATGG + Intronic
959991172 3:112633643-112633665 CAGGCTACGACTTTACCAGTTGG + Intronic
962027495 3:131563946-131563968 CAGGCTAAGACTTCACAAAATGG + Intronic
962075611 3:132078662-132078684 CAGGCTAATAATTCAGAAAGGGG + Intronic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
964427666 3:156570086-156570108 CAGGCACCTACTTCATAAAGTGG - Intergenic
968917342 4:3502334-3502356 CAGGCTTCCTGTTCACAAAGTGG + Intergenic
970611302 4:17727569-17727591 CAGGCAACTTCTTCACAAGGTGG + Intronic
970756980 4:19438256-19438278 CAGGCGACTTCTTCACAAGGTGG - Intergenic
974593680 4:63988746-63988768 CAGGCACCTTCTTCACAAAGTGG - Intergenic
974608463 4:64184020-64184042 CAGGCTATTACTTCAAATAGTGG - Intergenic
978251007 4:106631529-106631551 CAGGCTACCACTTCCCAAGCTGG - Intergenic
981176720 4:141691114-141691136 CAGGCACCTTCTTCACAAAGTGG + Intronic
981212462 4:142124219-142124241 CAAGCTAGGACTTGGCAAAGGGG - Intronic
983819026 4:172170363-172170385 CAGGCAACACCTTCACAAGGTGG - Intronic
984294171 4:177832544-177832566 CAGTCTACCACTTCACAGAAGGG - Intronic
990170008 5:53037575-53037597 GAGGCTAGGACATCACCAAGAGG - Intronic
994744585 5:103663196-103663218 CAGGCAACTTCTTCACAAGGCGG + Intergenic
995452374 5:112316264-112316286 CAGCTTACTCCTTCACAAAGGGG + Intronic
998322415 5:141245335-141245357 CAGGCTAAGGCTTCAAAAAAAGG + Intergenic
1004177310 6:13351000-13351022 CAGGCAGACACTTCACAAAGAGG - Intergenic
1004436866 6:15604278-15604300 CAGGCAATGACTTTACAAAAAGG - Intronic
1011911768 6:92449511-92449533 CAGGCTTGGACTTCAGAAACTGG + Intergenic
1018922829 6:168187415-168187437 CAGGCACCTTCTTCACAAAGTGG + Intergenic
1019129178 6:169860829-169860851 CAGGCATCTTCTTCACAAAGTGG - Intergenic
1019518093 7:1448388-1448410 CAGGCTGTGTCTTCACCAAGAGG - Intronic
1024308336 7:47946799-47946821 AAGGCTATGACTTCAGAAATGGG + Intronic
1024743597 7:52382393-52382415 ATGGCTATGACTTCAAAAAGTGG - Intergenic
1025625347 7:63216408-63216430 CAGCCTCCCTCTTCACAAAGTGG + Intergenic
1026189268 7:68109874-68109896 CAGGCTCCCTCTTCACAAGGTGG + Intergenic
1030454245 7:109752858-109752880 CATGCTCTGACTTCACATAGTGG - Intergenic
1031558799 7:123211366-123211388 CAGGCACCTTCTTCACAAAGTGG - Intergenic
1032868856 7:135958383-135958405 ACAGCTACTACTTCACAAAGTGG + Intronic
1034712404 7:153205137-153205159 CAGGCTAGGATTTCACACAAAGG - Intergenic
1036603131 8:10281757-10281779 CAGGCTGCTACTTCACAGACAGG - Intronic
1036950150 8:13132841-13132863 CAGGCACCGACTTGACAAGGCGG + Intronic
1042728355 8:71903209-71903231 CAGGCTGTGGCTTCACAAGGTGG - Intronic
1042950084 8:74192273-74192295 CAGGCACCTTCTTCACAAAGTGG + Intergenic
1048978351 8:139688396-139688418 CAGGCAACTTCTTCACAAGGTGG + Intronic
1050667258 9:7953653-7953675 CTGGCTACATCTTCACAAGGTGG - Intergenic
1055699457 9:78926922-78926944 AAGGCAATGACTTCAGAAAGCGG + Intergenic
1062083314 9:134635937-134635959 GAGGCTTCAGCTTCACAAAGTGG + Intergenic
1188127250 X:26384165-26384187 CAGGCTCCTTCTTCACAAGGTGG - Intergenic
1190324483 X:49198740-49198762 CAGTCTCCCACTTCACAACGGGG + Intronic
1190925454 X:54899660-54899682 CAGGCACCTACTTCACAAGGTGG + Intergenic
1196993403 X:121353745-121353767 CAGGCACCTTCTTCACAAAGTGG - Intergenic
1197649731 X:129051678-129051700 CAGGCACCTTCTTCACAAAGTGG + Intergenic
1200245512 X:154522163-154522185 CAGGCCACCCCTTCACCAAGGGG + Intergenic