ID: 932085639

View in Genome Browser
Species Human (GRCh38)
Location 2:68756237-68756259
Sequence GCAGCTTGTGCTCAACGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 286}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932085634_932085639 21 Left 932085634 2:68756193-68756215 CCTAGCCCTGTGGCAGGCTTTCC 0: 1
1: 0
2: 1
3: 30
4: 316
Right 932085639 2:68756237-68756259 GCAGCTTGTGCTCAACGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 286
932085632_932085639 23 Left 932085632 2:68756191-68756213 CCCCTAGCCCTGTGGCAGGCTTT 0: 1
1: 0
2: 0
3: 15
4: 143
Right 932085639 2:68756237-68756259 GCAGCTTGTGCTCAACGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 286
932085636_932085639 15 Left 932085636 2:68756199-68756221 CCTGTGGCAGGCTTTCCAGATGT 0: 1
1: 0
2: 2
3: 14
4: 178
Right 932085639 2:68756237-68756259 GCAGCTTGTGCTCAACGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 286
932085635_932085639 16 Left 932085635 2:68756198-68756220 CCCTGTGGCAGGCTTTCCAGATG 0: 1
1: 0
2: 2
3: 19
4: 223
Right 932085639 2:68756237-68756259 GCAGCTTGTGCTCAACGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 286
932085637_932085639 0 Left 932085637 2:68756214-68756236 CCAGATGTGCATACATTCCAGTA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 932085639 2:68756237-68756259 GCAGCTTGTGCTCAACGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 286
932085630_932085639 29 Left 932085630 2:68756185-68756207 CCTCTACCCCTAGCCCTGTGGCA 0: 1
1: 0
2: 4
3: 30
4: 390
Right 932085639 2:68756237-68756259 GCAGCTTGTGCTCAACGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 286
932085633_932085639 22 Left 932085633 2:68756192-68756214 CCCTAGCCCTGTGGCAGGCTTTC 0: 1
1: 0
2: 1
3: 6
4: 183
Right 932085639 2:68756237-68756259 GCAGCTTGTGCTCAACGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932085639 Original CRISPR GCAGCTTGTGCTCAACGTGC AGG Intronic
902162481 1:14542403-14542425 GGTACATGTGCTCAACGTGCAGG - Intergenic
902957668 1:19936923-19936945 GGGGCTTGTGCTCAATGTGAGGG - Intergenic
903157838 1:21460256-21460278 GATACTTGTGCACAACGTGCAGG + Intronic
906229878 1:44153048-44153070 GGTGCATGTGCACAACGTGCAGG + Intergenic
906320371 1:44812047-44812069 GCAGTTTGTGGTGAAGGTGCTGG + Exonic
908638747 1:66198642-66198664 GGTACTTGTGCACAACGTGCAGG + Intronic
908644869 1:66266386-66266408 GCAGCTTGACCTCAGCTTGCTGG + Intronic
909308979 1:74121615-74121637 GGTGCATGTGCACAACGTGCAGG + Intronic
911755687 1:101552095-101552117 GCAGAATGTGCAGAACGTGCGGG - Intergenic
911892041 1:103383289-103383311 GCTACATGTGCACAACGTGCAGG - Intergenic
912035322 1:105305294-105305316 GGTGCATGTGCACAACGTGCAGG + Intergenic
915389646 1:155530331-155530353 CCAGCTAGTGTTCTACGTGCTGG - Intronic
916643877 1:166762562-166762584 GGTACTTGTGCACAACGTGCAGG - Intergenic
916691592 1:167195107-167195129 GCTGCTTCTGCTCAACTTCCTGG - Intergenic
917139001 1:171815929-171815951 GATACTTGTGCTGAACGTGCAGG - Intergenic
917987882 1:180339640-180339662 GGTGCATGTGCACAACGTGCAGG - Intronic
919542712 1:198871397-198871419 GGTGCATGTGCACAACGTGCAGG + Intergenic
921271357 1:213473297-213473319 GCAGATTTTGCACAAAGTGCTGG - Intergenic
1064467599 10:15600143-15600165 GGTGCATGTGCACAACGTGCAGG + Intronic
1066200528 10:33139551-33139573 GGGGCTTGTGCTGAAGGTGCTGG - Intergenic
1068555635 10:58455691-58455713 GGTGCATGTGCACAACGTGCAGG + Intergenic
1069095797 10:64258347-64258369 GCTACATGTGCACAACGTGCAGG - Intergenic
1069161052 10:65092798-65092820 GGTGCATGTGCACAACGTGCAGG - Intergenic
1069640063 10:69949095-69949117 GCAGCTTGTCCTCTTCATGCCGG + Intronic
1069847306 10:71381278-71381300 GCAGGCTGTGCACAACGTGGGGG + Intergenic
1070701629 10:78606203-78606225 GGAACATGTGCACAACGTGCAGG + Intergenic
1071413299 10:85417953-85417975 GGAACATGTGCACAACGTGCAGG - Intergenic
1074516922 10:114179178-114179200 GCAGCTTGTGCTCTAGTTACAGG - Intergenic
1077291928 11:1800740-1800762 GGTGCATGTGCACAACGTGCAGG + Intergenic
1077841057 11:5975239-5975261 GGAACATGTGCACAACGTGCAGG + Intergenic
1080491422 11:32768430-32768452 GATGCATGTGCACAACGTGCAGG - Intronic
1081261257 11:40964402-40964424 GCTACATGTGCACAACGTGCAGG + Intronic
1081998414 11:47378656-47378678 GCAGGTGGTGCTCAAAGGGCTGG + Intergenic
1082181783 11:49128795-49128817 GGTGCATGTGCACAACGTGCAGG + Intergenic
1084219255 11:67667490-67667512 GCAGCTTCTGCGCGACGTGCTGG - Exonic
1084643199 11:70438053-70438075 GCAGCTTGCTCTCAGCCTGCTGG + Intergenic
1087224244 11:95580162-95580184 GGTGCATGTGCACAACGTGCAGG + Intergenic
1087243912 11:95811538-95811560 GGTACATGTGCTCAACGTGCAGG - Intronic
1087868691 11:103265337-103265359 GATACTTGTGCTGAACGTGCAGG - Intronic
1088657225 11:112011911-112011933 GGTGCATGTGCACAACGTGCAGG - Intronic
1089326056 11:117657939-117657961 GCAGTCTGTGCTCATTGTGCTGG - Intronic
1090215753 11:124962681-124962703 GGTGCATGTGCACAACGTGCAGG + Intronic
1090793084 11:130109157-130109179 GGAACATGTGCACAACGTGCAGG - Intronic
1090933270 11:131318624-131318646 GGAACATGTGCACAACGTGCAGG - Intergenic
1092549404 12:9481745-9481767 GGTACTTGTGCACAACGTGCAGG - Intergenic
1092605010 12:10108951-10108973 GGAACATGTGCACAACGTGCAGG - Intronic
1093882967 12:24426422-24426444 GGTGCATGTGCACAACGTGCAGG - Intergenic
1094405754 12:30114720-30114742 GGTACTTGTGCACAACGTGCAGG + Intergenic
1094445856 12:30529234-30529256 GATGCATGTGCACAACGTGCAGG - Intergenic
1094521859 12:31199399-31199421 GGTACTTGTGCACAACGTGCAGG + Intergenic
1096007797 12:48186084-48186106 GCAGCTTGAGGTCAAGGTCCAGG - Intergenic
1096664796 12:53156804-53156826 GGTGCATGTGCACAACGTGCAGG + Intergenic
1097560773 12:61203914-61203936 GGAACATGTGCTCAACGTGCAGG + Intergenic
1097751189 12:63354689-63354711 GCTACATGTGCACAACGTGCAGG - Intergenic
1100651824 12:96599041-96599063 GCTACATGTGCACAACGTGCAGG + Intronic
1101459681 12:104878345-104878367 GGTACTTGTGCACAACGTGCAGG + Intronic
1104705057 12:130938000-130938022 GGTGCATGTGCACAACGTGCAGG - Intergenic
1108656742 13:52540798-52540820 GAAACATGTGCTGAACGTGCAGG + Intergenic
1109946316 13:69436653-69436675 GGTACTTGTGCACAACGTGCAGG - Intergenic
1110063599 13:71071889-71071911 GCAGCCTGTACACAACTTGCAGG - Intergenic
1112628641 13:101136337-101136359 GGTGCATGTGCACAACGTGCAGG + Intronic
1114501577 14:23173231-23173253 GCAGCTTCTGCTCTGCGTGGTGG - Intronic
1114691791 14:24589649-24589671 GGTTCTTGTGCACAACGTGCAGG - Intergenic
1115189294 14:30729891-30729913 GGTGCGTGTGCACAACGTGCAGG + Intronic
1115235312 14:31203781-31203803 GGTACATGTGCTCAACGTGCAGG + Intronic
1115362858 14:32523286-32523308 GGAACATGTGCACAACGTGCAGG - Intronic
1115955091 14:38768794-38768816 GGTGCATGTGCACAACGTGCAGG - Intergenic
1116212176 14:41962584-41962606 GGTGCATGTGCACAACGTGCAGG + Intergenic
1116538554 14:46066648-46066670 GGTGCATGTGCACAACGTGCAGG - Intergenic
1116744319 14:48797225-48797247 GGTACTTGTGCACAACGTGCAGG - Intergenic
1117146174 14:52838737-52838759 GGTACATGTGCTCAACGTGCAGG - Intergenic
1118022680 14:61734869-61734891 GGTGCATGTGCACAACGTGCAGG - Intronic
1118262506 14:64260581-64260603 GCAGCTAGTGCTCACCCTCCTGG - Exonic
1118496570 14:66313587-66313609 GAAGCTTGAACTCAAGGTGCTGG + Intergenic
1120557476 14:85946407-85946429 GGTGCATGTGCACAACGTGCAGG - Intergenic
1120576569 14:86188405-86188427 GGTGCATGTGCACAACGTGCAGG - Intergenic
1122291432 14:100682368-100682390 GCTGTCTCTGCTCAACGTGCTGG + Intergenic
1123856645 15:24419134-24419156 GGTACGTGTGCTCAACGTGCAGG + Intergenic
1125038987 15:35161099-35161121 GTTGCATGTGCACAACGTGCAGG - Intergenic
1126541207 15:49826174-49826196 GGTGCATGTGCACAACGTGCAGG + Intergenic
1128113876 15:65093541-65093563 GCTGTTTGTGCTCCAGGTGCAGG - Intronic
1128627479 15:69224658-69224680 GCAGTTTGTACTCAGCTTGCAGG - Intronic
1129781289 15:78273459-78273481 GGTGCATGTGCACAACGTGCAGG + Intronic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1130729885 15:86480184-86480206 GGTGCATGTGCACAACGTGCAGG - Intronic
1132793443 16:1706507-1706529 GCCGCTGGTGGTGAACGTGCTGG + Exonic
1133431948 16:5744976-5744998 GCTACATGTGCACAACGTGCAGG + Intergenic
1133509669 16:6445271-6445293 GGTACATGTGCTCAACGTGCAGG + Intronic
1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG + Intergenic
1134898536 16:17912511-17912533 GCTACATGTGCACAACGTGCAGG - Intergenic
1135271326 16:21072277-21072299 GGTGCATGTGCACAACGTGCAGG + Intronic
1135386495 16:22045909-22045931 GGTGCATGTGCACAACGTGCAGG + Intronic
1136230007 16:28880339-28880361 CCAGCTTGTGCTTAACGCGACGG - Intronic
1139128900 16:64115952-64115974 GGTGCATGTGCACAACGTGCAGG - Intergenic
1139482309 16:67237235-67237257 GCAGCTTGTGCTCTACGAGGTGG - Exonic
1140487577 16:75305893-75305915 ACAGCCTGTGCTCCACTTGCTGG + Intronic
1140633274 16:76880597-76880619 GGTGCATGTGCACAACGTGCAGG - Intergenic
1140691342 16:77487418-77487440 GAAACTTGTGCAGAACGTGCAGG + Intergenic
1140983603 16:80136350-80136372 GGTACATGTGCTCAACGTGCAGG + Intergenic
1141674134 16:85508689-85508711 GCTGCTTGTGCTCAGTATGCTGG + Intergenic
1141924091 16:87155816-87155838 GATGCATGTGCTGAACGTGCAGG - Intronic
1141985720 16:87578496-87578518 GGTACTTGTGCACAACGTGCAGG + Intergenic
1142076150 16:88119361-88119383 GCAGCCTGTGGTGCACGTGCGGG + Intergenic
1142745255 17:1953511-1953533 GGAACATGTGCACAACGTGCAGG - Intronic
1144355406 17:14441188-14441210 GGTACTTGTGCACAACGTGCAGG + Intergenic
1148910447 17:50939749-50939771 GCAGCGTCTGCTCCACCTGCCGG - Intergenic
1149450519 17:56746451-56746473 GGTGCATGTGCACAACGTGCAGG - Intergenic
1153533639 18:6077016-6077038 TCAGCTTGTGCTCAGGGAGCAGG + Intronic
1155206022 18:23558754-23558776 GGTGCATGTGCACAACGTGCAGG + Intronic
1155861718 18:30909694-30909716 GCTACATGTGCACAACGTGCAGG - Intergenic
1156048109 18:32900015-32900037 GCAGCTCGTGCTCCATCTGCTGG - Intergenic
1157026386 18:43849356-43849378 GCTACATGTGCTGAACGTGCAGG + Intergenic
1159194124 18:65089075-65089097 GGTACATGTGCTCAACGTGCAGG - Intergenic
1159419711 18:68201743-68201765 GGTGCATGTGCACAACGTGCAGG - Intergenic
1159685245 18:71410894-71410916 GGTGCATGTGCACAACGTGCAGG + Intergenic
1159862482 18:73665361-73665383 GGTGCCTGTGCACAACGTGCAGG + Intergenic
1162100413 19:8335424-8335446 GGAGCGTGTGCTCGACGCGCGGG + Exonic
1162772603 19:12958347-12958369 GGTACTTGTGCACAACGTGCAGG + Intergenic
1162951307 19:14073426-14073448 GCGGCCGGTGCTCAACCTGCCGG + Exonic
1163405593 19:17120136-17120158 GCAGCTTGTGCCCAACTGTCAGG + Intronic
1167203857 19:48086659-48086681 GCAGCTGGTGCTCCACCTGCTGG + Intronic
1168167542 19:54561657-54561679 GGTACTTGTGCACAACGTGCAGG + Intergenic
1168442114 19:56378291-56378313 GTACCATGTGCACAACGTGCAGG - Intronic
925900376 2:8505100-8505122 GGTGCATGTGCACAACGTGCAGG + Intergenic
926124517 2:10264025-10264047 GGTGCATGTGCACAACGTGCAGG - Intergenic
926559149 2:14395988-14396010 GCTACATGTGCACAACGTGCAGG - Intergenic
926935333 2:18081724-18081746 GGTACTTGTGCACAACGTGCAGG - Intronic
927198504 2:20564313-20564335 GCAGCTTCTGCTCCACGTGATGG - Intronic
927690475 2:25204542-25204564 GCAGCCTCTGCTCACCCTGCAGG - Intergenic
928343408 2:30466972-30466994 GGTGCATGTGCACAACGTGCAGG + Intronic
928894816 2:36248492-36248514 GGTGCATGTGCACAACGTGCAGG + Intergenic
930464855 2:51735108-51735130 GGTACTTGTGCACAACGTGCAGG - Intergenic
932085639 2:68756237-68756259 GCAGCTTGTGCTCAACGTGCAGG + Intronic
932643219 2:73472720-73472742 GCAGCTTATACTCATGGTGCAGG + Intronic
933118158 2:78500017-78500039 GGTGCATGTGCACAACGTGCAGG + Intergenic
933529621 2:83490191-83490213 GATGCATGTGCACAACGTGCAGG - Intergenic
933529934 2:83495528-83495550 GGTACTTGTGCACAACGTGCAGG - Intergenic
937017638 2:118620267-118620289 GCAGCGTGTGTTCAAGGGGCAGG - Intergenic
938252542 2:129827262-129827284 CCAGCTCGTGCTTAAGGTGCAGG - Intergenic
939453427 2:142401310-142401332 GCAGCTTGAGCCCAAGGGGCTGG - Intergenic
939594847 2:144110499-144110521 GGTGCATGTGCACAACGTGCAGG - Intronic
939770483 2:146309561-146309583 GCTACATGTGCACAACGTGCTGG - Intergenic
939856651 2:147366643-147366665 GGTGCATGTGCACAACGTGCAGG + Intergenic
943012088 2:182462263-182462285 GGTGCATGTGCACAACGTGCAGG - Intronic
944231021 2:197392885-197392907 GATACTTGTGCTGAACGTGCAGG - Intronic
944623775 2:201548083-201548105 GGTACTTGTGCACAACGTGCAGG + Intronic
944948868 2:204723831-204723853 GCATATTGTGATCAACATGCTGG + Intronic
945446037 2:209939748-209939770 GGTACATGTGCTCAACGTGCAGG + Intronic
1169796395 20:9467386-9467408 GGTGCATGTGCACAACGTGCAGG - Intronic
1170989778 20:21291483-21291505 GGTACATGTGCTCAACGTGCAGG + Intergenic
1171091725 20:22291563-22291585 GCTACATGTGCTGAACGTGCAGG - Intergenic
1173958210 20:47051152-47051174 GCAGCCAGTGCTCAACGAGAGGG - Intronic
1174711497 20:52710959-52710981 GGTGCATGTGCACAACGTGCAGG + Intergenic
1175315882 20:58046344-58046366 GCAGCTTCTGCAGCACGTGCTGG - Intergenic
1177322087 21:19535882-19535904 GGTACATGTGCTCAACGTGCAGG + Intergenic
1177365416 21:20128858-20128880 GGTGCATGTGCACAACGTGCAGG - Intergenic
1179309987 21:40186711-40186733 ACAGCTTGAGCTCAACGCTCTGG + Intronic
1180602334 22:17030413-17030435 GGTACTTGTGCACAACGTGCAGG + Intergenic
1181449227 22:23006780-23006802 GGTGCATGTGCACAACGTGCAGG - Intergenic
1184006988 22:41717505-41717527 GCAGGTTGGTCTCAACCTGCTGG + Intronic
1184989712 22:48158871-48158893 GATGCATGTGCTGAACGTGCAGG + Intergenic
1185298172 22:50064404-50064426 TCAGCTTGTGTTCAACATACAGG + Intronic
949440774 3:4077764-4077786 GGTGCATGTGCACAACGTGCAGG - Intronic
949574688 3:5327565-5327587 GGTGCATGTGCACAACGTGCAGG + Intergenic
951091131 3:18575055-18575077 GGTGCATGTGCACAACGTGCAGG - Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
955615326 3:60801079-60801101 GCACCTAGGGCTCAACCTGCTGG + Intronic
957061326 3:75483491-75483513 GGTGCATGTGCACAACGTGCAGG + Intergenic
957505727 3:81118030-81118052 GGTACATGTGCTCAACGTGCAGG - Intergenic
958584625 3:96069922-96069944 GGTGCATGTGCACAACGTGCAGG + Intergenic
959203229 3:103274643-103274665 GGCGCATGTGCACAACGTGCAGG + Intergenic
959939944 3:112070810-112070832 GGTGCGTGTGCACAACGTGCAGG + Intronic
960872126 3:122260648-122260670 GGTACTTGTGCACAACGTGCAGG - Intronic
961936469 3:130590344-130590366 GGTACTTGTGCACAACGTGCAGG + Intronic
963415743 3:144993684-144993706 GGTACTTGTGCACAACGTGCAGG + Intergenic
968388282 4:165881-165903 GGTGCATGTGCACAACGTGCAGG + Intergenic
972776959 4:42250249-42250271 GGTGCATGTGCACAACGTGCAGG + Intergenic
973013343 4:45105282-45105304 GGTGCATGTGCACAACGTGCAGG + Intergenic
973123124 4:46547842-46547864 GGTGCATGTGCACAACGTGCAGG - Intergenic
974177200 4:58339423-58339445 GGTACTTGTGCACAACGTGCAGG - Intergenic
974774044 4:66457367-66457389 GGTGCATGTGCACAACGTGCAGG + Intergenic
975116080 4:70682623-70682645 GGTGCATGTGCACAACGTGCAGG - Intronic
975821078 4:78271346-78271368 GGTGCATGTGCACAACGTGCAGG + Intronic
976024393 4:80670021-80670043 GGTACTTGTGCACAACGTGCAGG + Intronic
976159306 4:82181500-82181522 GGTGCATGTGCACAACGTGCAGG - Intergenic
976592495 4:86862951-86862973 GGAACATGTGCACAACGTGCAGG - Intergenic
977755806 4:100670297-100670319 GGTGCATGTGCACAACGTGCAGG - Intronic
978932604 4:114334233-114334255 GGTGCATGTGCACAACGTGCAGG + Intergenic
979445789 4:120809351-120809373 GGAACATGTGCACAACGTGCAGG - Intronic
980001126 4:127489202-127489224 GGTACATGTGCTCAACGTGCAGG + Intergenic
982308514 4:153959272-153959294 GGAACATGTGCACAACGTGCAGG - Intergenic
982838266 4:160151197-160151219 GGTGCATGTGCACAACGTGCAGG + Intergenic
982998341 4:162380262-162380284 GGTACTTGTGCACAACGTGCAGG - Intergenic
983598174 4:169494131-169494153 GGAACATGTGCACAACGTGCAGG + Intronic
984921749 4:184770665-184770687 GGTGCATGTGCACAACGTGCAGG - Intronic
985468846 5:24403-24425 GGTGCATGTGCACAACGTGCAGG - Intergenic
985757334 5:1726739-1726761 GCAGCTCATCCTCAGCGTGCTGG - Intergenic
985930517 5:3053383-3053405 GGAACATGTGCACAACGTGCAGG - Intergenic
988010576 5:25476623-25476645 GGAACATGTGCACAACGTGCAGG - Intergenic
989143461 5:38224874-38224896 GGTACTTGTGCACAACGTGCAGG - Intergenic
989431951 5:41365975-41365997 GGTACTTGTGCACAACGTGCAGG + Intronic
989813264 5:45704204-45704226 GGAACATGTGCACAACGTGCAGG + Intergenic
990894417 5:60682474-60682496 GGTGCATGTGCACAACGTGCAGG - Intronic
991128581 5:63095067-63095089 GGTACTTGTGCACAACGTGCAGG - Intergenic
991438686 5:66622945-66622967 GCAGCTTGTGCTGTCCGTGGTGG + Intronic
993362016 5:86989082-86989104 GCTACATGTGCACAACGTGCAGG - Intergenic
993474857 5:88351776-88351798 GCTACATGTGCACAACGTGCAGG - Intergenic
994326621 5:98455054-98455076 GCATCTTATGCTCAAAGTGAAGG - Intergenic
995335304 5:110991691-110991713 GGTGCATGTGCACAACGTGCAGG - Intergenic
995395041 5:111678476-111678498 CCAGCTTGTGCTCACCGTGTTGG + Intronic
999335287 5:150710894-150710916 GCTGCTGTTACTCAACGTGCAGG + Exonic
1001332754 5:170773660-170773682 ACAGCTGGTGCTCTACCTGCTGG - Intronic
1001458167 5:171883486-171883508 GGTACATGTGCTCAACGTGCAGG - Intronic
1001905703 5:175471145-175471167 GGTACTTGTGCACAACGTGCAGG - Intergenic
1002370283 5:178746778-178746800 GGTGCATGTGCACAACGTGCAGG + Intergenic
1004826739 6:19430249-19430271 GGTACTTGTGCACAACGTGCAGG + Intergenic
1005184342 6:23148110-23148132 GCAGCTTGGGTTCAAGCTGCAGG - Intergenic
1008763428 6:54881796-54881818 GGGACTTGTGCACAACGTGCAGG + Intronic
1009058265 6:58365276-58365298 GCTACATGTGCACAACGTGCAGG - Intergenic
1009629243 6:66172897-66172919 GGTGCATGTGCACAACGTGCAGG - Intergenic
1010105060 6:72158441-72158463 GCTACATGTGCACAACGTGCAGG + Intronic
1010285998 6:74078886-74078908 GGTGCATGTGCACAACGTGCAGG + Intergenic
1011526138 6:88267108-88267130 GGTGCATGTGCACAACGTGCAGG + Intergenic
1011544812 6:88471481-88471503 GGTGCATGTGCACAACGTGCAGG - Intergenic
1012149983 6:95736427-95736449 GCAGCTTGTGCACAGCTTGCAGG + Intergenic
1013810158 6:114035569-114035591 GGCACTTGTGCACAACGTGCTGG - Intergenic
1013881873 6:114914665-114914687 GGTGCATGTGCACAACGTGCAGG + Intergenic
1014332318 6:120085395-120085417 GGTGCATGTGCACAACGTGCAGG + Intergenic
1014925117 6:127261088-127261110 GGTGCATGTGCACAACGTGCAGG - Intergenic
1015675775 6:135746615-135746637 GATGCATGTGCTGAACGTGCAGG - Intergenic
1017412071 6:154178247-154178269 GATACTTGTGCACAACGTGCAGG - Intronic
1017634818 6:156433157-156433179 GGTACTTGTGCACAACGTGCAGG + Intergenic
1017640190 6:156485893-156485915 GGTACTTGTGCACAACGTGCAGG + Intergenic
1018453485 6:163930745-163930767 GGTGCATGTGCACAACGTGCTGG + Intergenic
1021195409 7:17668739-17668761 GGTGCATGTGCGCAACGTGCAGG - Intergenic
1021242867 7:18226371-18226393 GGAGCATGTGCTCAACCTCCAGG - Intronic
1022454149 7:30543580-30543602 GGTGCATGTGCACAACGTGCAGG - Intronic
1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG + Intronic
1024827152 7:53404083-53404105 GAAGTTTGAGGTCAACGTGCTGG - Intergenic
1025473596 7:60890919-60890941 GGTGCATGTGCACAACGTGCAGG - Intergenic
1025513409 7:61598947-61598969 GGTGCATGTGCACAACGTGCAGG + Intergenic
1025537758 7:62027786-62027808 GGTGCATGTGCACAACGTGCAGG + Intergenic
1025720475 7:64007274-64007296 GGTGCTTGTGCACAACGTGCAGG + Intergenic
1026568512 7:71509786-71509808 GCAGCTGGGGTTCAACCTGCCGG + Intronic
1028258704 7:88633504-88633526 GGTACATGTGCTCAACGTGCAGG - Intergenic
1028638706 7:93019554-93019576 GTAACATGTGCACAACGTGCAGG + Intergenic
1030084586 7:105805704-105805726 GAAGCTTGTGCTCATCTTTCAGG - Intronic
1030101366 7:105948731-105948753 GGTACATGTGCTCAACGTGCAGG + Intronic
1031246202 7:119316131-119316153 GGAACATGTGCACAACGTGCAGG + Intergenic
1033535140 7:142305388-142305410 GCAGCTGCTGGTCAACCTGCAGG + Intergenic
1037069879 8:14630979-14631001 GCTACATGTGCACAACGTGCAGG - Intronic
1038217361 8:25574538-25574560 CCAGCTTTTGCTCAACGTTAGGG - Intergenic
1038625878 8:29192934-29192956 GCAGCCTGTGCTCTCCCTGCAGG - Intronic
1040790234 8:51220081-51220103 GGTACTTGTGCACAACGTGCAGG - Intergenic
1042767413 8:72339337-72339359 GGTGCATGTGCACAACGTGCAGG + Intergenic
1043139097 8:76565616-76565638 GGTACTTGTGCACAACGTGCAGG + Intergenic
1043415746 8:80047085-80047107 GCAGCTATTGTTCAAAGTGCTGG + Intronic
1043819531 8:84845077-84845099 GGTACTTGTGCACAACGTGCAGG - Intronic
1045142969 8:99308212-99308234 GGAACATGTGCACAACGTGCAGG + Intronic
1046162481 8:110385943-110385965 GATGCATGTGCACAACGTGCAGG + Intergenic
1046848013 8:118940288-118940310 GGTGCATGTGCACAACGTGCAGG - Intronic
1047201669 8:122772548-122772570 GCAGCTTCTGCTGCACCTGCTGG - Intergenic
1047417067 8:124673421-124673443 CCAGCTTTTACTCCACGTGCAGG - Intronic
1047849550 8:128841808-128841830 GGTGCATGTGCACAACGTGCAGG - Intergenic
1048138343 8:131768330-131768352 GAAGCTGGTGCTCCACCTGCAGG - Intergenic
1050034573 9:1421951-1421973 GGAACATGTGCACAACGTGCAGG + Intergenic
1050423529 9:5491153-5491175 GGTGCATGTGCACAACGTGCAGG - Intergenic
1050505283 9:6341954-6341976 GGAACATGTGCACAACGTGCAGG - Intergenic
1050573179 9:6964122-6964144 GCTACATGTGCACAACGTGCAGG + Intronic
1052222909 9:26048814-26048836 GGTGCATGTGCACAACGTGCAGG - Intergenic
1052662163 9:31447403-31447425 TAAGCTTGTGCTAAACATGCAGG + Intergenic
1052701864 9:31947693-31947715 GGTACTTGTGCACAACGTGCAGG + Intergenic
1053423164 9:37993517-37993539 GGTACTTGTGCACAACGTGCAGG - Intronic
1055652428 9:78419432-78419454 GGTGCATGTGCCCAACGTGCAGG + Intergenic
1055760880 9:79606410-79606432 GGTGCATGTGCACAACGTGCAGG + Intronic
1056361466 9:85861792-85861814 GGTGCATGTGCACAACGTGCAGG + Intergenic
1056557637 9:87703124-87703146 GCAGTTTGTGTACGACGTGCAGG + Exonic
1057978786 9:99636655-99636677 GGCACTTGTGCACAACGTGCAGG + Intergenic
1060337270 9:122737241-122737263 GGTACTTGTGCACAACGTGCAGG + Intergenic
1062000378 9:134212928-134212950 GCAGGTTGTGTGCAACATGCTGG + Intergenic
1190126479 X:47709964-47709986 GCAGCTTGCACACAACTTGCAGG - Intergenic
1191120626 X:56900019-56900041 GGAACATGTGCACAACGTGCAGG - Intergenic
1191233254 X:58114199-58114221 GGTACTTGTGCACAACGTGCGGG - Intergenic
1191893376 X:65967624-65967646 GGTACTTGTGCACAACGTGCAGG - Intergenic
1193595766 X:83443023-83443045 GGTACATGTGCTCAACGTGCAGG - Intergenic
1193684607 X:84561634-84561656 GGTGCATGTGCACAACGTGCAGG - Intergenic
1194508510 X:94763616-94763638 GCTACATGTGCACAACGTGCAGG + Intergenic
1195171114 X:102269400-102269422 GGTGCATGTGCACAACGTGCAGG - Intergenic
1195187746 X:102417699-102417721 GGTGCATGTGCACAACGTGCAGG + Intronic
1195340949 X:103905497-103905519 GGTACTTGTGCACAACGTGCAGG + Intergenic
1196158766 X:112459474-112459496 GGTGCATGTGCACAACGTGCAGG - Intergenic
1196345860 X:114657733-114657755 GGTACTTGTGCACAACGTGCAGG + Intronic
1197026245 X:121753485-121753507 GGTGCATGTGCACAACGTGCAGG + Intergenic
1200847434 Y:7845423-7845445 GGTACTTGTGCACAACGTGCAGG - Intergenic
1201542435 Y:15120785-15120807 GCTACTTGTGCACAACGTGCAGG + Intergenic
1202026951 Y:20534291-20534313 GGTACTTGTGCACAACGTGCAGG - Intergenic