ID: 932085709

View in Genome Browser
Species Human (GRCh38)
Location 2:68756823-68756845
Sequence AGTGCCTGATGAAGACCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932085706_932085709 12 Left 932085706 2:68756788-68756810 CCCACTCAAAGGGGAAAACAAAG 0: 1
1: 0
2: 2
3: 48
4: 496
Right 932085709 2:68756823-68756845 AGTGCCTGATGAAGACCTGATGG 0: 1
1: 0
2: 0
3: 15
4: 167
932085707_932085709 11 Left 932085707 2:68756789-68756811 CCACTCAAAGGGGAAAACAAAGA 0: 1
1: 0
2: 2
3: 42
4: 430
Right 932085709 2:68756823-68756845 AGTGCCTGATGAAGACCTGATGG 0: 1
1: 0
2: 0
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932085709 Original CRISPR AGTGCCTGATGAAGACCTGA TGG Intronic