ID: 932085709 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:68756823-68756845 |
| Sequence | AGTGCCTGATGAAGACCTGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 183 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 15, 4: 167} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 932085706_932085709 | 12 | Left | 932085706 | 2:68756788-68756810 | CCCACTCAAAGGGGAAAACAAAG | 0: 1 1: 0 2: 2 3: 48 4: 496 |
||
| Right | 932085709 | 2:68756823-68756845 | AGTGCCTGATGAAGACCTGATGG | 0: 1 1: 0 2: 0 3: 15 4: 167 |
||||
| 932085707_932085709 | 11 | Left | 932085707 | 2:68756789-68756811 | CCACTCAAAGGGGAAAACAAAGA | 0: 1 1: 0 2: 2 3: 42 4: 430 |
||
| Right | 932085709 | 2:68756823-68756845 | AGTGCCTGATGAAGACCTGATGG | 0: 1 1: 0 2: 0 3: 15 4: 167 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 932085709 | Original CRISPR | AGTGCCTGATGAAGACCTGA TGG | Intronic | ||