ID: 932087256

View in Genome Browser
Species Human (GRCh38)
Location 2:68773500-68773522
Sequence AAGTGGGGAAGGCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2582
Summary {0: 1, 1: 3, 2: 28, 3: 227, 4: 2323}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932087256 Original CRISPR AAGTGGGGAAGGCAGGAGGA AGG Intronic
Too many off-targets to display for this crispr