ID: 932087733

View in Genome Browser
Species Human (GRCh38)
Location 2:68776603-68776625
Sequence GGCCAAAAAAGCAATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932087733_932087737 3 Left 932087733 2:68776603-68776625 CCAACCTCATTGCTTTTTTGGCC 0: 1
1: 0
2: 0
3: 25
4: 229
Right 932087737 2:68776629-68776651 GTGGTGTGTGAGAATAAAAGAGG 0: 1
1: 1
2: 0
3: 33
4: 310
932087733_932087738 26 Left 932087733 2:68776603-68776625 CCAACCTCATTGCTTTTTTGGCC 0: 1
1: 0
2: 0
3: 25
4: 229
Right 932087738 2:68776652-68776674 ATGCTCTGAACAATTACGCCAGG 0: 1
1: 0
2: 1
3: 6
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932087733 Original CRISPR GGCCAAAAAAGCAATGAGGT TGG (reversed) Intronic
901943259 1:12680142-12680164 CCCCAAAGAAGCAATGAGGCTGG + Intergenic
902827297 1:18985360-18985382 GGCCAAGGAGGCAATCAGGTGGG + Intergenic
902988914 1:20172344-20172366 GGCCACAAAAGCAAATAGGTGGG - Intronic
903574327 1:24329030-24329052 GGCCCAGGAAGCAATGAGGAGGG + Intronic
904485326 1:30821102-30821124 TTCAAAAAAAGAAATGAGGTGGG - Intergenic
907064407 1:51466044-51466066 GGGAAAAAAAGGAGTGAGGTGGG + Intronic
908022339 1:59910966-59910988 GGCAAATAATGCAATGAGCTTGG + Intronic
909517888 1:76532939-76532961 GGCAAGCAAAGAAATGAGGTGGG + Intronic
910784611 1:90982559-90982581 CTCAAAAAAAGCAGTGAGGTTGG - Intronic
911353777 1:96790843-96790865 GCCCAAAAAAGGAAGGGGGTGGG + Intronic
913574702 1:120160566-120160588 GGCCATCAAAGTACTGAGGTAGG + Intronic
914295971 1:146325406-146325428 GGCCATCAAAGTACTGAGGTAGG + Intergenic
914557011 1:148776192-148776214 GGCCATCAAAGTACTGAGGTAGG + Intergenic
914615823 1:149354038-149354060 GGCCATCAAAGTACTGAGGTAGG - Intergenic
915696318 1:157746195-157746217 TGCCAAAAAATCAAGGAGGAAGG + Exonic
915846659 1:159273426-159273448 GACAAAAAAAGCAATAAGGAAGG + Intergenic
918972983 1:191444212-191444234 AGCCAAAAGAGCAATGATGGAGG - Intergenic
919905639 1:202076537-202076559 GGGCAGGAAAGAAATGAGGTTGG - Intergenic
919926121 1:202192743-202192765 GGCAAAAAAAGGAAGGAGGGGGG + Intergenic
921937224 1:220806557-220806579 CCCCAAAAAGGCCATGAGGTTGG - Intronic
924265334 1:242275990-242276012 GACTGAAAGAGCAATGAGGTTGG + Intronic
1063070121 10:2653122-2653144 CGTCCAAAAAGCAATGAGCTAGG + Intergenic
1063677079 10:8150300-8150322 GGCCAAACAACCAATGTGGTTGG + Intergenic
1065009406 10:21407998-21408020 GGCCAAAAAGGCAATCATTTGGG + Intergenic
1066719488 10:38322500-38322522 GACTGAAAGAGCAATGAGGTTGG - Intergenic
1068173121 10:53421984-53422006 GGCCAAAAAAACTATGACCTAGG - Intergenic
1069286721 10:66723786-66723808 AGCCAAGAAAGGAATGAGGCAGG + Intronic
1069490700 10:68857971-68857993 GGCTAGAAAAGCAATAAGGCAGG + Intronic
1071090771 10:81915403-81915425 GGCCAAAAAGGAGATGAGGTGGG + Intronic
1071171086 10:82864916-82864938 CACAAAAAAAGCAATGATGTTGG - Intronic
1071388789 10:85149178-85149200 GGCCAAAAAGGCAATCATTTGGG - Intergenic
1071581977 10:86780075-86780097 GGCCAAAAAACAAATGAAATAGG - Intronic
1071739709 10:88343383-88343405 GCCCAAAAAAGCTAGGAGATTGG + Intronic
1072972061 10:100025940-100025962 GGCCAAAAAGGCAATCATTTGGG + Intergenic
1074059267 10:109950142-109950164 GTTCAAAAAAGAAAGGAGGTAGG + Intronic
1074121880 10:110498968-110498990 GGTCAAAAAGGCAAGGGGGTCGG - Intronic
1075550404 10:123388558-123388580 TGCCATAAAAGCAGTGAGGAGGG + Intergenic
1076856823 10:133120440-133120462 GGCCAAGATAGCGATGAGGGAGG - Intronic
1078453066 11:11454604-11454626 GGCACAAAGGGCAATGAGGTGGG + Intronic
1080287205 11:30629065-30629087 AGCCAAAAAACCAGTAAGGTTGG + Intergenic
1081286747 11:41279683-41279705 GGCCAAAAAGGAAATGACCTAGG - Intronic
1082990641 11:59204910-59204932 GGCCAGAAAAGCTTTGAGGTGGG + Exonic
1084327014 11:68406362-68406384 GGCCAACCCAGCCATGAGGTCGG + Intronic
1084437276 11:69151061-69151083 GACAAAAAAAGCAATGGGGAAGG + Intergenic
1085003235 11:73060731-73060753 GGCCAGAAAAGCAAAGCTGTGGG + Intronic
1087253191 11:95926456-95926478 GGCCAAAAAAGAAATCAAGAAGG + Intergenic
1087887205 11:103494816-103494838 GGCCAAAAAGGCAATAATTTGGG - Intergenic
1088951920 11:114580340-114580362 TGCCAAAGAATCAATGAGATAGG + Intronic
1091427787 12:406478-406500 GGTCACAGAAGTAATGAGGTTGG + Intronic
1091788238 12:3256091-3256113 GGCCAAAGCAGCAAAGGGGTGGG - Intronic
1091998408 12:5013772-5013794 GGCAAAATAAGAAATGAGGCCGG + Intergenic
1092491764 12:8951861-8951883 GGCCAAAAATGCAATTGAGTAGG + Intronic
1092626208 12:10332080-10332102 TGCCAAAAAAATAATAAGGTTGG + Intergenic
1093192057 12:16086257-16086279 AGCCAAAAAACAAATGAGGAAGG + Intergenic
1094583128 12:31752634-31752656 GGCCAAAAAAGCAATCATTTGGG + Intergenic
1095887882 12:47207604-47207626 GTCCATAAAAGCAAAGAGGAAGG - Intronic
1096048676 12:48586837-48586859 GGCCCAAAATGGAGTGAGGTAGG + Intergenic
1096587861 12:52634884-52634906 TGCCCAAAAAGCTATCAGGTCGG + Intergenic
1097493813 12:60302429-60302451 GACCAAAATTGCAATGAAGTGGG - Intergenic
1099463838 12:82957981-82958003 TCCCAAAAAATCAAGGAGGTCGG + Intronic
1100052532 12:90466832-90466854 GTCCACAAAAACAATGAGTTTGG + Intergenic
1103401448 12:120645828-120645850 GGAAAAAAAAGAAATGAGGAAGG + Intronic
1104177890 12:126350752-126350774 GACCAGTAAAGCAATGAGGTGGG + Intergenic
1104617527 12:130283198-130283220 AGCAAACAGAGCAATGAGGTGGG + Intergenic
1107702525 13:43062274-43062296 GGCCAAAAAAGAAACAAGGCAGG + Intronic
1108076983 13:46691641-46691663 GAGCAAGAAAGCAACGAGGTTGG + Intronic
1108554597 13:51580741-51580763 AGCCAAATAATCAATGGGGTGGG + Intergenic
1110014902 13:70387651-70387673 GGCTGAAAAAGCAGTGAGGTAGG - Intergenic
1111501300 13:89123426-89123448 GGTCAAAAAAAAAAAGAGGTAGG - Intergenic
1112249764 13:97769108-97769130 AGCTAAAAAAGCACTGCGGTGGG - Intergenic
1112260616 13:97874809-97874831 GGCCGAAGAAGCAATCAGATAGG + Intergenic
1112887847 13:104195376-104195398 GTCCAGAAAGGCAATGATGTGGG - Intergenic
1113903779 13:113809927-113809949 GGGGAAGAAAGAAATGAGGTTGG + Intronic
1114656640 14:24319656-24319678 GGCCAGAAAAGCAAAGTGGAAGG + Intronic
1114951259 14:27757007-27757029 GATCCAAAAAGCAATGAGCTTGG + Intergenic
1124185413 15:27522534-27522556 GCCATAAATAGCAATGAGGTTGG + Intronic
1125386089 15:39138303-39138325 TGCCAGAAAAGCAATGTGCTAGG + Intergenic
1125437991 15:39668607-39668629 GGCAATAAAAGGAATGAAGTTGG - Intronic
1126122763 15:45268284-45268306 AGCCAAAAAGGCAATCAGGTTGG - Exonic
1126787116 15:52186413-52186435 GGCCCACAAAGCAATGTAGTGGG + Intronic
1127843515 15:62849803-62849825 GGCCAAAAAAGCAGGGAATTTGG - Intergenic
1128247433 15:66142696-66142718 GGACAAAAAAGCACAGAAGTGGG + Intronic
1129476899 15:75791767-75791789 GGGCAAAGAAGGAAGGAGGTTGG + Intergenic
1130766307 15:86874931-86874953 GCCCAGAAAAGTTATGAGGTTGG - Intronic
1133808727 16:9145009-9145031 GGCCAAAAAGGCAATCATTTGGG - Intergenic
1133828156 16:9297444-9297466 GGCCAAAAAAGTAATGGTGGTGG + Intergenic
1136773988 16:32861425-32861447 ATCCAAAAAAGCCATGAGGTTGG - Intergenic
1136896621 16:34000094-34000116 ATCCAAAAAAGCCATGAGGTTGG + Intergenic
1137274462 16:46924415-46924437 GGCCAAAAAAGCAAAGCTGACGG + Exonic
1138343162 16:56303979-56304001 GATCTAAAAAGCAATGAAGTAGG - Intronic
1139480508 16:67227939-67227961 GGGCATAGAAGCAAGGAGGTAGG - Intronic
1139831196 16:69799630-69799652 GGCTAGAAAAGCAATGATTTAGG - Intronic
1141220920 16:82068655-82068677 GGACAGAAAAGCAATGAGCTGGG - Intronic
1203076410 16_KI270728v1_random:1123536-1123558 ATCCAAAAAAGCCATGAGGTTGG - Intergenic
1143417738 17:6761952-6761974 GGCCATAAAGGAAATGATGTGGG + Intronic
1143626377 17:8112457-8112479 GGCCAAAACACCAGTGAGGGTGG - Intronic
1143979421 17:10855258-10855280 TGCCAAAAGACCAATGAGGTAGG - Intergenic
1144259571 17:13505013-13505035 AGCCAAAAAAGAGATAAGGTAGG + Intronic
1151265056 17:72948417-72948439 GGGCAAATGAGCAATGAAGTTGG + Intronic
1153576711 18:6529133-6529155 TTCCAAAAAAGCAAGGAGGAAGG - Intronic
1155022882 18:21912634-21912656 GGCCAAAAAAGCAAAGGACTAGG + Intergenic
1156063725 18:33114945-33114967 GGTCAAAAAATAGATGAGGTTGG + Intronic
1156895150 18:42237516-42237538 AGCCAAAAAAATAATGAGGGAGG - Intergenic
1157958560 18:52126443-52126465 GGCCAAAAAGGCAATCATTTGGG - Intergenic
1157999358 18:52598374-52598396 TCTCAAAAAAGGAATGAGGTAGG + Intronic
1158522202 18:58180739-58180761 GGACAGAAAAGCAATGTGATGGG - Intronic
1161387882 19:4006565-4006587 GGCCAAAAAAAAAATTAGCTGGG + Intergenic
1162432263 19:10636224-10636246 GGCCAGGAAAACCATGAGGTAGG - Intronic
1167447985 19:49550169-49550191 GCCCTAAAAAGGAATGACGTTGG - Intergenic
925530525 2:4855783-4855805 TTCCAAAAAACCAAAGAGGTTGG + Intergenic
925826459 2:7852812-7852834 GGCAAAATAAGGAATGAAGTAGG - Intergenic
926063333 2:9818578-9818600 GGCTGAAAAAGGAATGAGGAAGG + Intergenic
931825707 2:65998285-65998307 GGCCAGAAATGCAAAGTGGTGGG - Intergenic
931940254 2:67244173-67244195 GGCCAAATGAGCCATGAGGAGGG + Intergenic
932087733 2:68776603-68776625 GGCCAAAAAAGCAATGAGGTTGG - Intronic
933978893 2:87534557-87534579 GGGGAAAAAAGGAAGGAGGTGGG - Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
936314936 2:111416242-111416264 GGGAAAAAAAGGAAGGAGGTGGG + Intergenic
939316106 2:140551326-140551348 GGGCAAATAAGCAAAGAGGAGGG + Intronic
941048669 2:160705681-160705703 GGTTGAAAAAGCAATGAAGTAGG + Intergenic
942200735 2:173568305-173568327 GGCCAAGAGGGCAATGAGGCAGG + Intergenic
942702560 2:178730128-178730150 TGCCAACTAAGCAATGATGTTGG - Exonic
943733524 2:191328765-191328787 GGCCAAAACATCATGGAGGTGGG - Intronic
944518189 2:200533638-200533660 GGGCAAAAAAAAAAGGAGGTGGG + Intronic
944639986 2:201715019-201715041 AGCCAAAAATGCAATGGGGTTGG + Intronic
945031632 2:205670144-205670166 GGCCAAAAAAGAAATTAAGGAGG - Intergenic
946185005 2:217975795-217975817 AGCCAGAAAAGCAGTGAGGAGGG - Intronic
946878600 2:224155514-224155536 GGGCCAAAAAGCAAGGAGGAAGG - Intergenic
1168978707 20:1987134-1987156 GGGTGAAAAAGCAAAGAGGTGGG + Intronic
1169324564 20:4664835-4664857 GGCCAAAAAGGCAATCATTTGGG + Intergenic
1170804556 20:19618212-19618234 GACTAACAAAGCAATGAAGTTGG - Intronic
1171106123 20:22434555-22434577 GGCCACAAAAGCACTGGGGTAGG - Intergenic
1173305000 20:41839705-41839727 GACCAAAAAAACAAGGAGGAGGG - Intergenic
1174183246 20:48688086-48688108 AGCCAAAAAAAAAATGGGGTGGG + Intronic
1174909964 20:54597026-54597048 GGGTACAAATGCAATGAGGTTGG + Intronic
1175335431 20:58193025-58193047 GACCTAGAAAGGAATGAGGTTGG + Intergenic
1175618647 20:60424527-60424549 GGCCAAAAAGGCTGGGAGGTGGG + Intergenic
1180576372 22:16779128-16779150 CCCCAAGAAAGCTATGAGGTGGG + Intergenic
1183572164 22:38661790-38661812 GGCCAAAAAAGGCAGGAGGAGGG - Intronic
1184600987 22:45543275-45543297 GGAAAAAAAAGAAATGAGGCTGG + Intronic
950976759 3:17254845-17254867 GGCCAAGAAAGGAAAAAGGTTGG + Intronic
951145420 3:19220720-19220742 GGCCAAATAAGGAATAAGATGGG - Intronic
953381783 3:42477684-42477706 GGCCAAAAAAGCCCTCAGATAGG - Intergenic
954601867 3:51876464-51876486 GGGGAAGACAGCAATGAGGTGGG + Intergenic
956647030 3:71466231-71466253 GGCCAGGAAAGCAGAGAGGTTGG - Intronic
957129549 3:76205669-76205691 GGCCTGAAAAGCAAAGAGGAGGG - Intronic
958070385 3:88603280-88603302 GACCAAACAAGCAGTGAGATTGG + Intergenic
958431137 3:94043138-94043160 GGCCAAAAAAATAATGAATTTGG + Exonic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
960694992 3:120387494-120387516 GGAAAAAAAAAGAATGAGGTAGG + Intergenic
964504879 3:157388367-157388389 AGCCAAAGAAGCATTGGGGTGGG - Intronic
964773184 3:160246094-160246116 GGCCAAAAAAAAAAAGATGTTGG + Intronic
966952718 3:184837598-184837620 GGAGAAAAAAGCAATGAGCAAGG - Intronic
967513198 3:190336602-190336624 GGCCACATAAGCCATGTGGTAGG - Intronic
969147648 4:5138055-5138077 GGGAAAAAAAGCAATGAGCTTGG - Intronic
969657444 4:8506495-8506517 GGCCAAATCAGCAATGAGCATGG - Intergenic
969925487 4:10581767-10581789 GGGCAATCAAGGAATGAGGTGGG - Intronic
973026721 4:45283128-45283150 GGCAAGAAAAGGAATGAGTTTGG - Intergenic
979845995 4:125512766-125512788 GGGTAAAAAAACAATGAGCTGGG - Intergenic
980411312 4:132423150-132423172 GGGTAAAAGAGGAATGAGGTAGG + Intergenic
981005487 4:139870642-139870664 GTCCAAAAAAAGAAAGAGGTAGG - Intronic
983028844 4:162772786-162772808 GGCTACAAAAGCAAGGAAGTTGG - Intergenic
983048106 4:163011052-163011074 GCCCATAAAAGCAATAAGGAGGG - Intergenic
983315561 4:166128512-166128534 TGCCAAAAATGAAATGAAGTGGG - Intergenic
983840406 4:172450649-172450671 GGAGAGAAAAGGAATGAGGTTGG - Intronic
985119252 4:186623305-186623327 GGCCAAAAATGCAATCAGGAAGG - Intronic
988727635 5:33939841-33939863 GGCCAAAAAACCAATGATGCAGG + Intergenic
989328154 5:40224185-40224207 TGCCACAAAAGCAATGAGACTGG - Intergenic
989406850 5:41070908-41070930 GGCTAAAAAATCAAAGAGGCAGG + Exonic
990255832 5:53967869-53967891 GGCCAAAGAAGCTATGAAGGAGG + Intronic
990691432 5:58368576-58368598 AGCCTAAATAGCAATAAGGTTGG + Intergenic
992061342 5:73051073-73051095 GGGCAAGAAATCACTGAGGTGGG - Intronic
993037771 5:82775900-82775922 GGCAGAAAAAGCAATAATGTTGG - Intergenic
993238033 5:85341286-85341308 GGGAAAAAAGGCAATGAGATGGG + Intergenic
994386340 5:99137300-99137322 TGCCAAAATAGAAATTAGGTGGG - Intergenic
996909918 5:128644338-128644360 GAGAAAAAAAGCAATGAGGGTGG - Intronic
996929258 5:128866599-128866621 GGCAAAAAATGCGAAGAGGTGGG + Intronic
999285204 5:150390561-150390583 GGCCCAAAGAGCAATGAACTGGG - Intronic
999863926 5:155679739-155679761 GGCCAAAAAGGCAATCATTTTGG - Intergenic
999962089 5:156766838-156766860 GGCCACAGCAGCAAAGAGGTTGG + Intronic
1000093077 5:157947070-157947092 GACAAAAAAAGGAAGGAGGTTGG - Intergenic
1001015498 5:168137232-168137254 GGTCAAATTAGCAATGAAGTTGG + Intronic
1001171155 5:169420060-169420082 GGCCAAAAAAGAATTGAGTGAGG + Intergenic
1002820074 6:716722-716744 AGCCAACAAAGCCAGGAGGTGGG + Intergenic
1003447265 6:6195990-6196012 GGCTAAATCAGCAATGAAGTTGG - Intronic
1004052459 6:12099460-12099482 GGCCAAAAACTCAGTGAGGCCGG - Intronic
1004988692 6:21112875-21112897 GACCGAAGAAGTAATGAGGTGGG - Intronic
1007348005 6:41247695-41247717 GGCCAGAAAAGCAAGAAGGGTGG - Intergenic
1007598575 6:43067122-43067144 GGCCAAAACAGCAATGGTGGGGG - Intronic
1008294688 6:49761260-49761282 TGCCAGAAAAGCCATGAGATGGG - Intergenic
1008879504 6:56366520-56366542 TGCCAAAAAAGCAACTAGCTGGG + Intronic
1009026369 6:58005153-58005175 GGTCTAAAAAGCAATCAAGTTGG + Intergenic
1009201919 6:60756626-60756648 GGTCTAAAAAGCAATCAAGTTGG + Intergenic
1009670392 6:66741091-66741113 GTCCAAGAAAGGCATGAGGTTGG - Intergenic
1010117337 6:72329707-72329729 GGCCAGAAAACCAATTTGGTTGG + Intronic
1013495541 6:110693562-110693584 GGGCACAACAGGAATGAGGTTGG + Intronic
1013618280 6:111865110-111865132 GTGCAAATAAGCAATGAGCTAGG + Intronic
1014406086 6:121052842-121052864 GAGAAAAAAAGCAATGGGGTTGG - Intergenic
1014664988 6:124226715-124226737 GGTCAAAAAAGTAAAGAGATTGG - Intronic
1014962857 6:127708059-127708081 TGCTAAAAAAGCCATGAGGAGGG - Intronic
1015525417 6:134171295-134171317 GGAAAAGAAAGCATTGAGGTGGG - Intronic
1015705270 6:136081026-136081048 GACAAACAAATCAATGAGGTTGG + Intronic
1017735037 6:157354996-157355018 GTCAAATAAAGCAATGAGGCTGG - Intergenic
1018560268 6:165095266-165095288 GGGCAAGCAAGGAATGAGGTGGG - Intergenic
1020472556 7:8555650-8555672 GACGAACAAAGAAATGAGGTTGG - Intronic
1020780505 7:12511642-12511664 AGCCAAAAAAGCAATCAAGAAGG - Intergenic
1021091453 7:16487426-16487448 GGCCAAACCAGCAAGGAGCTTGG - Intronic
1021786254 7:24155700-24155722 TGCCAAAGAAGCCGTGAGGTGGG + Intergenic
1023136885 7:37061522-37061544 GGCCACAAAAGCATTGTGGACGG - Intronic
1023467110 7:40468420-40468442 GGCCAAAAAAGGAAGGAGGGAGG - Intronic
1024711372 7:52018827-52018849 GTCCAAAACAGAAATGAGGTGGG + Intergenic
1027495076 7:78877844-78877866 GCTCAAAAAAGCTATGATGTAGG - Intronic
1027662948 7:81009263-81009285 GTCCAGACAAGCAATGAGGGTGG + Intergenic
1029025669 7:97414447-97414469 GGGTTATAAAGCAATGAGGTAGG + Intergenic
1032545138 7:132735965-132735987 GGCCAAAGAAGCATGGAAGTAGG - Intergenic
1033337367 7:140465119-140465141 GGCCACAGAAGCAATGGGGTGGG - Intronic
1033957407 7:146868278-146868300 GACAAAACAAGCAATGAGGAAGG - Intronic
1037570108 8:20150680-20150702 GGCCAACACACCAAAGAGGTTGG + Exonic
1039255058 8:35709809-35709831 GGACACAAATGCTATGAGGTGGG + Intronic
1040356654 8:46624941-46624963 GGCCAAAACAGAAAAGAGGCAGG - Intergenic
1040408247 8:47130249-47130271 TGCCAAAAAAGCAAAAAGGTTGG + Intergenic
1043626459 8:82266708-82266730 GGCCCAACATGCAATGAGCTTGG - Intergenic
1044965536 8:97570481-97570503 GGCCAAAGCAGCAATCAGCTGGG - Intergenic
1046045945 8:108965000-108965022 CGTCAAAAAAGGAATGAAGTAGG + Intergenic
1046778838 8:118193607-118193629 TGCCCAAAAAGCAGTGAGGTAGG - Intronic
1047184737 8:122622697-122622719 GGCCCTAAAAGCAATAAGTTTGG - Intergenic
1049091911 8:140521856-140521878 GGCTAGAAAAGCAATGATGAGGG + Intergenic
1050014053 9:1214719-1214741 GGCCACAAAATCACTGAGCTGGG + Intergenic
1050037738 9:1454921-1454943 AATCAAAAAAGAAATGAGGTTGG + Intergenic
1051202029 9:14636812-14636834 GGCCAAGAAAGAAACTAGGTAGG + Intronic
1055461019 9:76520310-76520332 GGAAAAAAAAGCAATAATGTTGG + Intergenic
1056479999 9:86992766-86992788 GGCCAAAAAATCATTTATGTTGG - Intergenic
1058455045 9:105130870-105130892 GGGCAAAAAAAGAATGAGGCTGG + Intergenic
1061197481 9:129115193-129115215 TCCCATAAAAGCAATGTGGTTGG + Intronic
1061513879 9:131077205-131077227 GGCCCAGAAAGCACTGAGGACGG + Exonic
1185804481 X:3044828-3044850 GGCCAAAAAGGCAATCATCTGGG + Intronic
1187973144 X:24678394-24678416 ATCCAAAAAAGCAAAAAGGTAGG - Intergenic
1188280068 X:28256228-28256250 GGACAAAAAAGCAACCAGCTAGG + Intergenic
1189275606 X:39783420-39783442 CACCAAAACAGCAATGAGTTTGG - Intergenic
1190525740 X:51327836-51327858 GGGAAAAAAAACAATGAGGGAGG + Intergenic
1191690616 X:63934352-63934374 GGCCAAAAAGGCACAGAGGGAGG + Intergenic
1193704123 X:84800127-84800149 GGCCAATAAAGGAAGGAGGCGGG - Intergenic
1194411721 X:93565967-93565989 GGCCAAAAAGGCAATCATTTGGG + Intergenic
1196025271 X:111035204-111035226 TCACAACAAAGCAATGAGGTTGG - Intronic
1196884932 X:120235421-120235443 GGCAAAGAAAGCAATCAGATAGG - Intergenic
1197291631 X:124665760-124665782 GGCAAATAAAGCAAAGAGGAAGG + Intronic
1197532978 X:127653507-127653529 GACAAAAAAAGCAATGGGGAAGG + Intergenic
1197853543 X:130890211-130890233 GTCCCAAAAGGCAATGAGGTGGG + Intronic
1199971610 X:152865869-152865891 GGCCGAAAATGCCATGAGGGCGG - Exonic
1200105969 X:153712648-153712670 ATCCAAAAAAGCCATGAGGTTGG + Intronic
1202114537 Y:21458098-21458120 GGCCAAGAAAGCTATGTGGGAGG + Intergenic
1202162346 Y:21948443-21948465 GGCCAAGAAAGCCATGTGGATGG - Intergenic
1202229010 Y:22637930-22637952 GGCCAAGAAAGCCATGTGGATGG + Intergenic
1202314144 Y:23558235-23558257 GGCCAAGAAAGCCATGTGGATGG - Intergenic
1202556658 Y:26112360-26112382 GGCCAAGAAAGCCATGTGGATGG + Intergenic