ID: 932088342

View in Genome Browser
Species Human (GRCh38)
Location 2:68782273-68782295
Sequence CCACAAACCCAGAAGAAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 321}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932088339_932088342 2 Left 932088339 2:68782248-68782270 CCAGGATGTACAATCAAGGAGAT 0: 1
1: 0
2: 1
3: 8
4: 103
Right 932088342 2:68782273-68782295 CCACAAACCCAGAAGAAGCTGGG 0: 1
1: 0
2: 1
3: 26
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932088342 Original CRISPR CCACAAACCCAGAAGAAGCT GGG Exonic
900343353 1:2199093-2199115 CCAGAAAGCCAGGAGCAGCTGGG + Intronic
900825839 1:4925994-4926016 CCACAAACCCACAGAAAGATAGG + Intergenic
902544314 1:17178368-17178390 CCAGTAACCCACAAGAAGGTAGG + Intergenic
903018788 1:20379310-20379332 CCACAACCCCAGAAGAGGAGAGG + Intergenic
903082274 1:20820286-20820308 CCACCAACTCAGAAGAGGCAGGG - Intronic
904813284 1:33178109-33178131 CCTCGAAGCCAGAGGAAGCTGGG - Intronic
905445442 1:38025743-38025765 CCACACACCCACATGAAGGTAGG + Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906132599 1:43469430-43469452 CCACAGAGCCAGCAGGAGCTGGG - Intergenic
906147339 1:43567828-43567850 CCACAAGCCCAGCACAAGATGGG - Intronic
906385402 1:45364408-45364430 CCAAAAACCTACCAGAAGCTAGG + Intronic
909639542 1:77856901-77856923 ACCCAAACCCAGAAGAAGAAAGG - Intronic
910689974 1:89955651-89955673 CCAAAGACCCAGGAAAAGCTGGG - Intergenic
910873119 1:91853041-91853063 CCACAGACCCCCAAGTAGCTGGG - Intronic
912062288 1:105687511-105687533 CCTCAAACTCAGAAGCAGGTGGG + Intergenic
912477501 1:109949090-109949112 CCTCAGCCCCAGAAGTAGCTGGG - Intergenic
913104619 1:115601230-115601252 ACAGAAAACCTGAAGAAGCTGGG + Intergenic
915107678 1:153544646-153544668 CCACTCACCCCCAAGAAGCTGGG + Exonic
915751197 1:158212699-158212721 CCACAGAGCCAGCAGAAGCCAGG + Intergenic
916388176 1:164300645-164300667 CCTCAAACACAGAAGAAGAAAGG - Intergenic
916492127 1:165311338-165311360 ACACAAACCCACATAAAGCTGGG - Intronic
916806189 1:168263963-168263985 CCTCAAACTCCCAAGAAGCTAGG + Intergenic
917257820 1:173134743-173134765 CCCAAAACACAGAAGAAGTTTGG - Intergenic
917330895 1:173879308-173879330 GCAAAAATCCTGAAGAAGCTAGG - Intronic
917447682 1:175120498-175120520 CAACAATCACAGAAGAAGCCTGG - Intronic
918011848 1:180594064-180594086 CAACAAAACCAGAAGAAGGCTGG - Intergenic
921834773 1:219766843-219766865 ACCCAAACCCAGAAGAAGAAGGG + Intronic
922218379 1:223539252-223539274 GCACAATCACAGAAGCAGCTTGG - Intronic
922451227 1:225739043-225739065 GCAGAAAGCCAGAAGCAGCTTGG + Intergenic
922980312 1:229820518-229820540 CCATAAACCCAGGAGAAGAGGGG - Intergenic
923330627 1:232920735-232920757 CCAGAAAACCAGCAGAAGCCAGG + Intergenic
923354042 1:233136301-233136323 CCCTAAACCTAGAAGAATCTTGG + Intronic
923905200 1:238376789-238376811 CCACAAACACAGGAAAAGATGGG - Intergenic
924878972 1:248137114-248137136 CCACCAGCCCAGCAGTAGCTGGG + Intergenic
1062908389 10:1195283-1195305 CCACAAACCCTGAGGATGGTGGG - Intronic
1067327378 10:45282114-45282136 CCCCTAACACAGCAGAAGCTAGG + Intergenic
1067940586 10:50651623-50651645 CCACAAACCCCAAAGAGACTGGG + Intergenic
1068348336 10:55813203-55813225 CCACCAACTCAGAAGAGGCATGG - Intergenic
1069475833 10:68731704-68731726 CCTCAGCCTCAGAAGAAGCTGGG + Intronic
1070073771 10:73115290-73115312 CCTCAAACCCCCAAGTAGCTGGG + Intronic
1070155769 10:73834211-73834233 CTTAAAACCCAGTAGAAGCTGGG - Intronic
1072773599 10:98166182-98166204 AAACAAACCAAGAAGAAGCCAGG + Intronic
1073882703 10:108001974-108001996 CCAGCAACCCAGTGGAAGCTGGG - Intergenic
1074664480 10:115704209-115704231 CCAGCAACCCACCAGAAGCTAGG - Intronic
1074908951 10:117889940-117889962 CCAGAAACCAAGAAAAATCTCGG - Intergenic
1076170162 10:128312419-128312441 CCACATACCCAGAATCAGCCTGG - Intergenic
1076658205 10:132037932-132037954 CCACAAATCTGGAAGAAGCCGGG + Intergenic
1076917180 10:133430115-133430137 CCTCCAGCCCAGGAGAAGCTGGG - Intergenic
1076937275 10:133574874-133574896 CCTCCAGCCCAGGAGAAGCTGGG - Intergenic
1077629231 11:3799420-3799442 CAGCAAACCGAGAAGCAGCTGGG - Intronic
1078345659 11:10545243-10545265 CCACCAACTCAGAAGCAGGTGGG + Intergenic
1078349459 11:10580708-10580730 CCACAAAACAGGAAAAAGCTGGG + Intronic
1078353714 11:10617330-10617352 CCACAAATACAGAAGGAGCAAGG + Intronic
1078642830 11:13112322-13112344 CCAGAAAACCACCAGAAGCTAGG + Intergenic
1078733953 11:14002731-14002753 CCCCAAACACAGTAGAAGATAGG + Intronic
1080276096 11:30504885-30504907 CCAGAAACCCAGGAGAAGGCAGG + Intronic
1082865485 11:57896407-57896429 CCAGCAAACCACAAGAAGCTAGG - Intergenic
1083354139 11:62053135-62053157 CCCCTAACACAGGAGAAGCTAGG - Intergenic
1083553665 11:63609317-63609339 AGAAAAACCCATAAGAAGCTAGG + Intronic
1084404576 11:68963790-68963812 CCAAAACCCCAGAAGAAGGTGGG - Intergenic
1085424978 11:76396428-76396450 CCACAGCCCCCGAAGTAGCTGGG + Intronic
1086200703 11:84198047-84198069 ACACAAACCCAGAAAAAGTATGG - Intronic
1086264842 11:84985593-84985615 ACACAAACCCAGCAGAAGAAAGG + Intronic
1087757991 11:102074433-102074455 ACACAAGCACAGAAGGAGCTGGG - Intronic
1092011222 12:5114349-5114371 CCAAAAACCTTGGAGAAGCTGGG - Intergenic
1093177565 12:15929572-15929594 ACACACACACAGAAGAAGCTTGG - Intronic
1094501578 12:31026002-31026024 ACCCAAACCCAGAAGAAGAAAGG + Intergenic
1097424125 12:59420632-59420654 ACAGAAAAGCAGAAGAAGCTTGG + Intergenic
1099612556 12:84892903-84892925 CCTCAGTCCCAGAAGTAGCTGGG + Intronic
1100405591 12:94270469-94270491 CCACAAACCCACAAACAGGTTGG + Intronic
1100532952 12:95477482-95477504 CCAAACACCCAGAAGGAGCTAGG - Intronic
1101884744 12:108652492-108652514 CTACAAACCCAGCAGTAGTTGGG + Intronic
1101999913 12:109550933-109550955 CCAAAAACCTGGAAGAGGCTGGG - Intergenic
1102259395 12:111435201-111435223 CCACAAAGCCAGGACCAGCTCGG - Intronic
1103843380 12:123883854-123883876 CCACACACCCAGAACAGGCACGG - Intronic
1106852909 13:33814493-33814515 CGACAAAGACAGAACAAGCTTGG - Intergenic
1108027145 13:46189910-46189932 CAGCAAACCCACCAGAAGCTGGG - Intronic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1108118653 13:47159984-47160006 CCACAGAGCCAGCAGGAGCTGGG + Intergenic
1108458661 13:50642971-50642993 CCAGAAACTAAGAAGAAGCAAGG + Intronic
1109478790 13:62919867-62919889 CCACCAACTCAGAAGAGGGTGGG + Intergenic
1111050171 13:82872553-82872575 CCTCAGCCCCAGAAGCAGCTAGG + Intergenic
1111376179 13:87381243-87381265 GCAAAAATCCTGAAGAAGCTAGG + Intergenic
1113781306 13:112979174-112979196 CTACAAACCCAGAGGAAGGGAGG - Intronic
1114369945 14:22075744-22075766 CCAGAAAACCACGAGAAGCTGGG + Intergenic
1116130767 14:40854192-40854214 CCACAAAGCAGGAAGAAGCTGGG + Intergenic
1118169837 14:63377839-63377861 CAAAAAAGCCAGAAGAAGATTGG - Intronic
1119036038 14:71231251-71231273 CCACAGACCCAGTGGGAGCTGGG + Intergenic
1120403929 14:84070409-84070431 CCTCAAACTCACAGGAAGCTGGG + Intergenic
1120492864 14:85198833-85198855 CCACAAAACCAGAAGAGGACAGG + Intergenic
1120568561 14:86089963-86089985 CTACAAACCCAGAAAAGGCCTGG - Intergenic
1121252662 14:92511519-92511541 CCACCCACCCAGAAGCCGCTGGG + Intergenic
1121973980 14:98385593-98385615 CCACCAACTCAGAAGGAGCAGGG - Intergenic
1124487005 15:30126642-30126664 CCACAACCCCCCAAGTAGCTGGG - Intergenic
1124542088 15:30595617-30595639 CCACAACCCCCCAAGTAGCTGGG - Intergenic
1124548733 15:30657405-30657427 CCACAACCCCCCAAGTAGCTGGG - Intronic
1124756520 15:32411680-32411702 CCACAACCCCCCAAGTAGCTGGG + Intergenic
1127323326 15:57868368-57868390 CCACAAACCCACCAGAAGGAAGG - Intergenic
1127844303 15:62856410-62856432 CCACAGAGGGAGAAGAAGCTGGG + Intergenic
1129943174 15:79516453-79516475 CCACAAACGTAGTAGAAGGTGGG - Intergenic
1132302671 15:100785754-100785776 TCACAAGCCCCTAAGAAGCTGGG + Intergenic
1135774193 16:25241983-25242005 CCTCAACCCCAGAAGTTGCTGGG + Intronic
1137389691 16:48071023-48071045 CCACCAACCTAGATGAGGCTGGG + Intergenic
1137967800 16:52953763-52953785 AGGCAAACCCTGAAGAAGCTGGG + Intergenic
1139045777 16:63057766-63057788 CCACTAACCAAGATGAAGCTGGG - Intergenic
1141577408 16:84973056-84973078 CCACCAACCCTGCAGAAGCCAGG + Intergenic
1143746760 17:9000716-9000738 CCATAAAACCAGAAGATGCTGGG + Intergenic
1144407926 17:14970613-14970635 ACCCAAACCCAGAAGAAGAAAGG - Intergenic
1146375392 17:32290443-32290465 CCACCAATCTAGAAGAAACTGGG + Intronic
1148190880 17:45677897-45677919 GTGCAAACCCAGAATAAGCTGGG - Intergenic
1148540980 17:48480235-48480257 CCTCAATCCCACAAGTAGCTGGG - Intergenic
1149402665 17:56313930-56313952 CCACCAACCCAGTACAACCTAGG + Intronic
1149740528 17:59041256-59041278 CCACAAACCCAGGACAATCTGGG + Intronic
1151028453 17:70706599-70706621 CCAGCAAGCCAGATGAAGCTGGG + Intergenic
1151412212 17:73938543-73938565 GTGCAAACCAAGAAGAAGCTGGG + Intergenic
1151566141 17:74899492-74899514 CCAGAAACCCAGAGGAAGAGTGG - Intergenic
1151578286 17:74963636-74963658 CCCAAATCCCAGAAGAGGCTTGG + Intronic
1151774434 17:76189797-76189819 CAACAAACCCAGAACCAGCTGGG - Intronic
1152555168 17:81049450-81049472 CAAAAAACCCAGAAAAACCTAGG - Intronic
1154946956 18:21171423-21171445 CCACAGTCCCACAAGTAGCTGGG - Intergenic
1155128215 18:22901774-22901796 CTACAAACCAAGAAGAAGCCTGG + Intronic
1156708121 18:39908524-39908546 GGGCAAACCCAGAAGAAGTTTGG - Intergenic
1158124707 18:54088338-54088360 CCATACACCCATAAGAAGATTGG + Intergenic
1158578751 18:58662863-58662885 CCAAAAATATAGAAGAAGCTGGG + Intergenic
1158715303 18:59873782-59873804 CCAGATGCACAGAAGAAGCTTGG - Intergenic
1161249105 19:3270912-3270934 CCCCAACCCCAGAACAAGGTGGG + Intronic
1161940133 19:7397379-7397401 CCACAAACTCCCAAGTAGCTGGG + Intronic
1162157411 19:8688195-8688217 CCACAAACCCCTGAGTAGCTGGG + Intergenic
1163376211 19:16932303-16932325 CCTCAGACCCCCAAGAAGCTAGG - Intronic
1164982299 19:32623357-32623379 CCATACTCCCAGAAGAAACTCGG - Intronic
1165013259 19:32863845-32863867 CCACCACGCCAGGAGAAGCTGGG + Intronic
1165097730 19:33418770-33418792 CGACAAACACAGACAAAGCTAGG + Intronic
1165745310 19:38227192-38227214 CCTCAAACCCCCAAGTAGCTGGG + Intronic
1166368210 19:42287753-42287775 CCACCCCACCAGAAGAAGCTGGG - Intronic
1167150299 19:47704990-47705012 CCACAAGCCAAGGAGAACCTGGG - Intergenic
1167193478 19:48008838-48008860 CAAAAATCTCAGAAGAAGCTGGG + Intronic
1167708896 19:51098450-51098472 CCTGAAACCCTGAAGAAGCTGGG - Exonic
1168395819 19:56047263-56047285 CCCCAAACCCAGCAGAAGAAAGG - Intronic
926449576 2:12985968-12985990 CCAGATACTCAGAAGAAACTGGG - Intergenic
926672700 2:15590908-15590930 ACACACACACAGAAGAAGCCGGG - Intergenic
929378965 2:41326589-41326611 TCAGAAGCCCAGAAGTAGCTAGG + Intergenic
929895385 2:45955566-45955588 CCTCAAACTCTGAAGTAGCTGGG - Intronic
930966553 2:57335623-57335645 CCACAAACCCACCAGAAGGAAGG + Intergenic
931865880 2:66410733-66410755 CCACAGCCTCAGGAGAAGCTGGG + Intergenic
931988864 2:67769117-67769139 CCACCAGCCCAGAAGGAGCAGGG + Intergenic
932088342 2:68782273-68782295 CCACAAACCCAGAAGAAGCTGGG + Exonic
932880547 2:75497733-75497755 CCTCAGCCCCAGAAGTAGCTGGG - Intronic
932976886 2:76613448-76613470 CCAAAAACTCAAGAGAAGCTGGG - Intergenic
935519047 2:104081503-104081525 CCACAAAGGCAGAAAAAGCATGG - Intergenic
937041844 2:118828177-118828199 CCAAAAATACAGAAAAAGCTGGG + Intergenic
937312763 2:120912104-120912126 CCACAAACCCAAGAGCAGCCTGG - Intronic
937324952 2:120984947-120984969 CCACACACCCAGCAGGAGCCTGG - Intronic
937543603 2:122988916-122988938 CCACTGAGCCAGCAGAAGCTGGG + Intergenic
937572920 2:123385961-123385983 GCCCAAACCCAGAAGAAGAAAGG + Intergenic
938798773 2:134740834-134740856 CCAAAAACCCAGATGAGGCCAGG + Intergenic
940708183 2:157129733-157129755 CCCCAAAGCTAGCAGAAGCTAGG + Intergenic
942271073 2:174275928-174275950 CCACAAAGGAAGAAGAAGCATGG - Intergenic
942540357 2:177008945-177008967 CCACAAACCCACCAGAAGGAAGG + Intergenic
942726344 2:179012082-179012104 ACCCAAACCCAGAAGAAGAAAGG + Intronic
943603993 2:189954414-189954436 TCACCAAACCAGAAGAAGTTTGG - Intronic
943972697 2:194431388-194431410 CCAGAAAACCACTAGAAGCTAGG - Intergenic
944022878 2:195126388-195126410 CCACAGACCCAGTGGGAGCTAGG - Intergenic
944602370 2:201316170-201316192 ACACAAACCCAGCAGAAGAAAGG + Intronic
944787577 2:203088859-203088881 GCAAAAATCCAGAAGAAGCTAGG - Intronic
945091963 2:206184078-206184100 CCAGCAAACCACAAGAAGCTAGG - Intronic
945404883 2:209433361-209433383 CCTCAAAGCAGGAAGAAGCTTGG + Intronic
946028576 2:216687611-216687633 CCCCAACTCCAAAAGAAGCTTGG - Intronic
946177086 2:217928595-217928617 CCCCAAACCCAGCACAGGCTGGG + Intronic
947328670 2:229005066-229005088 CCAGCAAACCAGCAGAAGCTAGG + Intronic
948779375 2:240308455-240308477 CCACAAACCCGGAGGCAGATAGG + Intergenic
948997086 2:241586883-241586905 CCAGAGACCCAGAAGAAGATAGG + Intronic
1168851440 20:979750-979772 CCCCAAATGCAGAAGGAGCTGGG - Intronic
1169091993 20:2866554-2866576 GCACAAGCCCAGAAGAAGTGAGG + Exonic
1169160896 20:3377571-3377593 CCTCAGCCCCACAAGAAGCTGGG + Intronic
1169163148 20:3399776-3399798 ACACAAACACAGAAGAGGCCTGG + Intronic
1169221253 20:3824340-3824362 ACACACAGCCAGATGAAGCTTGG + Exonic
1170768694 20:19313542-19313564 CCACTGACCCAGAACAGGCTGGG - Intronic
1175564506 20:59962403-59962425 CCAGCAACCCACCAGAAGCTGGG - Intronic
1175749158 20:61483308-61483330 CCACAAACACAGATCAAACTGGG - Intronic
1175881635 20:62262761-62262783 CCTCACACCCAGCAGAACCTTGG - Intronic
1177174063 21:17684932-17684954 ACCCAAACCCAGCAGAAGATAGG - Intergenic
1177698690 21:24608525-24608547 CCTCAAACCCTCAAGTAGCTGGG - Intergenic
1178315586 21:31564027-31564049 CCTCAGACCCCCAAGAAGCTGGG - Intergenic
1178858059 21:36266625-36266647 CCACAAACCCCAAAGTAACTGGG - Intronic
1179169673 21:38963086-38963108 CCAGCAACCCAGCAGAAGCTGGG + Intergenic
1179271725 21:39856640-39856662 TTACATACCCACAAGAAGCTGGG - Intergenic
1181542005 22:23578595-23578617 CCACCCACCCAGAGGATGCTGGG - Intronic
1181898818 22:26135493-26135515 CCAGCAAACCACAAGAAGCTAGG + Intergenic
1183700476 22:39448328-39448350 CCACAAAGCCACAGGAAGGTGGG - Intergenic
1183798425 22:40140754-40140776 CCTCAAACTCCCAAGAAGCTGGG + Intronic
1184107579 22:42377084-42377106 CCACAACACCAGGAGAAGCAAGG - Intergenic
1185069424 22:48647985-48648007 CTGCAAAGCCAGAAGAAGATAGG + Intronic
950666105 3:14496027-14496049 CCTCAGCCCCACAAGAAGCTGGG - Intronic
950761662 3:15235439-15235461 CCAAACACGAAGAAGAAGCTTGG - Intronic
951136358 3:19107892-19107914 CCACTGACTCAGAAGAAGCAGGG + Intergenic
952126129 3:30302866-30302888 CCACAATCCCCCAAGTAGCTGGG + Intergenic
954407490 3:50353549-50353571 CCACCAGCCCAGAAGTAGCATGG - Exonic
955487743 3:59451794-59451816 CCACAAACCCAGAAGACTGGAGG + Intergenic
958010904 3:87878325-87878347 CAGCAATCCCAGAAGAAGCCTGG + Intergenic
958775381 3:98476741-98476763 GCCCAAACCCAGAAGAAGAAAGG - Intergenic
960034187 3:113086520-113086542 ACACAAATCCAGCAGGAGCTGGG + Intergenic
961380705 3:126494855-126494877 ACACACACCCAGCAGAAACTGGG + Intronic
961407430 3:126691349-126691371 ACCCAAACCCAGAAGAAGAAAGG + Intergenic
961434098 3:126904640-126904662 CCACAGACCCAGAAGAGGCATGG + Intronic
962837593 3:139202860-139202882 TCACCAACCCAGAAGCATCTTGG - Intronic
963765132 3:149326912-149326934 CCATAGACCTGGAAGAAGCTGGG + Intronic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
964338754 3:155685862-155685884 TCACAAACACACAAGAGGCTTGG + Intronic
964667496 3:159190207-159190229 GCACAAATCCAGAAGAGTCTTGG - Intronic
965712366 3:171568282-171568304 CCAGAGACACAGAAGAAGCATGG + Intergenic
966923324 3:184628706-184628728 CCACCAGCCCAGAATAAGGTTGG + Intronic
967216484 3:187215019-187215041 CCAGCAAACCAGCAGAAGCTAGG - Intergenic
968831925 4:2936821-2936843 CCACAAATCTAGAAGAGTCTGGG - Intergenic
968890822 4:3367560-3367582 CCACATCCCCAGAAGATTCTGGG - Intronic
969052189 4:4380850-4380872 CCCCAAACCCAGCAGAGGCAGGG - Intronic
969251771 4:5973031-5973053 CCACAAACCTGGAAGAATGTTGG - Intronic
969670183 4:8585865-8585887 CCACAAACACAGCAGCTGCTGGG - Intronic
970527709 4:16949228-16949250 CCAGCAAACCACAAGAAGCTAGG - Intergenic
970653839 4:18208735-18208757 AAACAAACCTAGAAAAAGCTAGG - Intergenic
971483094 4:27131653-27131675 CCAGCAACCCATCAGAAGCTAGG - Intergenic
971893927 4:32564802-32564824 CCAGAAACTCAGAAGAAGCATGG - Intergenic
972499022 4:39660538-39660560 ATACAAACCCACAGGAAGCTGGG - Intergenic
972763266 4:42128047-42128069 CCAGCTACCCAGAATAAGCTGGG + Intronic
973811597 4:54575725-54575747 TCACTATCCCAGGAGAAGCTAGG + Intergenic
973842059 4:54872508-54872530 CCACTGACTCAGAAGATGCTCGG - Intergenic
974381486 4:61146200-61146222 CCAGAAAGCCTGAAGAAACTTGG + Intergenic
975547428 4:75574041-75574063 CCCAAAACCCAGAAGAAGAAAGG + Intergenic
976452378 4:85205596-85205618 CCCCAAACCCAGCAGAAGAAAGG - Intergenic
976640714 4:87334672-87334694 GCAGAAACCCAGAAGAACCTTGG - Intergenic
976856732 4:89612893-89612915 ACCCAAACCCAGAAGAAGAAAGG + Intergenic
977474186 4:97484185-97484207 ACCCAAACCCAGAAGAAGAAAGG + Intronic
978280127 4:107001580-107001602 CCCCAAACCTGGAAGATGCTTGG + Intronic
978316686 4:107445668-107445690 ACCCAAACCCAGAAGAAGAAAGG - Intergenic
978390731 4:108222633-108222655 CCACAGACCCAGAACCAGCAGGG + Intergenic
979323958 4:119357289-119357311 CAACAAACACACAAAAAGCTAGG - Intergenic
980086954 4:128401148-128401170 ACACAAACCCAGCAGAAGAAAGG - Intergenic
980450029 4:132958757-132958779 CCACAAAGCCGGCAGGAGCTGGG + Intergenic
980599768 4:135006887-135006909 CCACAAACCCAGATCAGGCATGG - Intergenic
980703025 4:136457268-136457290 CCACCAACTCAGAAGGAGCAGGG - Intergenic
980819796 4:137999343-137999365 CAACAAACCTAGAACAAACTGGG + Intergenic
982273394 4:153615065-153615087 ATTCAAACCCAGAAGAAGCCTGG - Intronic
982306208 4:153933858-153933880 CCTCACATCCAGAAGCAGCTGGG - Intergenic
982630894 4:157827695-157827717 ACACAAACCCAGCAGAAGAAAGG + Intergenic
983241800 4:165241973-165241995 CAACAAACACACAAAAAGCTAGG - Intronic
985148114 4:186915712-186915734 ACACAAACCCAGAAGCAGGTTGG - Intergenic
985802728 5:2016037-2016059 CCACACACCCAGAAAAGCCTTGG - Intergenic
985998928 5:3614944-3614966 TCACAAAACCAGAAAAAGGTGGG - Intergenic
986354752 5:6912897-6912919 CAACAACCCCAGAAGAAGTAGGG + Intergenic
986483670 5:8214123-8214145 CCAGGAAACCAGCAGAAGCTGGG - Intergenic
986560191 5:9053176-9053198 CCACCATCCCAGAAATAGCTTGG - Intronic
987002197 5:13671219-13671241 CCAGCAAACCAAAAGAAGCTAGG - Intergenic
987414208 5:17646297-17646319 ACTCAAACCCAGAAGAAGAAAGG - Intergenic
988615422 5:32770312-32770334 CCTCAACCCCACAAGTAGCTGGG - Intronic
990923608 5:60994466-60994488 CCACAGACCCTGCAGAAGCTGGG - Intronic
993709898 5:91214304-91214326 CCAGAAAACCATCAGAAGCTAGG - Intergenic
994473252 5:100236944-100236966 CTACAAACCCAGAAGAGATTAGG - Intergenic
995016727 5:107318341-107318363 CCACAAACCCAGGAACACCTGGG + Intergenic
995353186 5:111205830-111205852 CCAAAAACTCAGAAGAGGATTGG - Intergenic
996240235 5:121190075-121190097 CCAAGAAGCCAGCAGAAGCTAGG - Intergenic
997039510 5:130234944-130234966 CCAGAAAACCACAAGAAGCTAGG - Intergenic
997457136 5:134025897-134025919 CCTCCAACCCAGTAGAGGCTGGG - Intergenic
998102110 5:139443189-139443211 CCACAAACCCAGGAAAAGACTGG + Intronic
998327593 5:141295470-141295492 CCACAAAAACAAAAGAAGTTAGG + Intergenic
998775721 5:145599382-145599404 CCACAAACCCTTAGGAGGCTTGG + Intronic
999498839 5:152126285-152126307 ACATAAACCCACCAGAAGCTGGG + Intergenic
1000180019 5:158799790-158799812 CCAGAAACCCAGACGATGCTAGG - Intronic
1000609367 5:163357762-163357784 CCGGAAAACCACAAGAAGCTGGG + Intergenic
1001387677 5:171353383-171353405 CCTCAGCCCCACAAGAAGCTGGG + Intergenic
1001834993 5:174824287-174824309 CCACACACACAGAAAAAGGTGGG - Intergenic
1002397226 5:178967437-178967459 CCAGAAACCTAGAAAAAGCAGGG - Intergenic
1002417973 5:179130608-179130630 CCACAGCCCCAGAAGAGGCCTGG + Intronic
1004606699 6:17201486-17201508 CCACAAACCCAGTAGAAGGTAGG + Intergenic
1004905518 6:20233747-20233769 CCACAAACCCTGAGCTAGCTAGG - Intergenic
1006579012 6:35065858-35065880 GCACAGGCCCAGAAGAACCTGGG - Intronic
1009057497 6:58354815-58354837 CCACAAAATCAGAAGATGCATGG + Intergenic
1009233315 6:61092264-61092286 CCACAAAATCAGAAGATGCATGG - Intergenic
1010904879 6:81475499-81475521 ACACAAACCAGGAAGAAGCTTGG - Intergenic
1011327408 6:86164562-86164584 CCAAAAACCCAGCAGAAGAAAGG + Intergenic
1012003326 6:93681657-93681679 CCACAACCTCCCAAGAAGCTGGG + Intergenic
1012183459 6:96184478-96184500 ACCCAAACCCAGAAGAAGAAAGG - Intronic
1012187522 6:96238169-96238191 CCACAAACTCCCAAGTAGCTGGG + Intergenic
1013776138 6:113680346-113680368 CCGCAATCCCTGAAGCAGCTGGG + Intergenic
1015528858 6:134200786-134200808 CCTCAGCCCCACAAGAAGCTGGG - Intronic
1020050430 7:5077776-5077798 CCACAAACCCAGGATGGGCTGGG + Intergenic
1020192628 7:6011859-6011881 ACAAAAACCCAAAAGAAGTTAGG - Intronic
1020669399 7:11087723-11087745 CCACACACACAGATGAAGCATGG - Intronic
1021576387 7:22109513-22109535 TCACAAAACCAGAACAAGGTAGG - Intergenic
1021606040 7:22410564-22410586 CCAGAAACAGAAAAGAAGCTTGG - Intergenic
1021615074 7:22494814-22494836 TCACAAACCAAGAAGAAATTTGG - Exonic
1022666672 7:32417177-32417199 CCCCAAACCAAGAAAAAGCTGGG + Intergenic
1023064333 7:36361593-36361615 CTAAAAACTCAAAAGAAGCTAGG + Intronic
1023557123 7:41435440-41435462 CCACAAACCCACCAGAAGGAAGG + Intergenic
1024147848 7:46535460-46535482 CCAAAAACCCACCAGTAGCTAGG - Intergenic
1028309744 7:89316520-89316542 CCACAAACGCAGAAAAAGGAAGG + Intronic
1028377421 7:90159808-90159830 TCACAAACCAAGAAGAACTTTGG + Exonic
1028993158 7:97072180-97072202 ACACAAACCCAGCAGAAGAAAGG - Intergenic
1030204508 7:106939878-106939900 CCAGAAAAGCAGAGGAAGCTTGG + Intergenic
1032016746 7:128384861-128384883 CCACAAATACAAAAGAAGGTTGG + Intergenic
1033136325 7:138787466-138787488 CAACAAACCTAGAGGCAGCTTGG + Intronic
1033888206 7:145974687-145974709 AGACAAACCCAGAAGAAACTTGG + Intergenic
1034228410 7:149500324-149500346 CAACACACCCAGAAGGAGCCTGG + Intergenic
1034541691 7:151762590-151762612 CCCCAAACACAGAGGATGCTTGG - Intronic
1034777127 7:153838280-153838302 CCACAAACCCAGTGGAAGGGTGG + Intergenic
1037732106 8:21534701-21534723 CCAGAAAACCACCAGAAGCTAGG - Intergenic
1038255230 8:25945120-25945142 TCACAAGGCCTGAAGAAGCTTGG - Intronic
1039123088 8:34170642-34170664 CCAGCAAACCATAAGAAGCTAGG - Intergenic
1040370728 8:46770328-46770350 CCAGATACCAAGAAGAAGCATGG + Intergenic
1040711291 8:50192209-50192231 GAACAAAACCAGAAGCAGCTTGG + Intronic
1041459975 8:58100557-58100579 CCAGCAAACCAGCAGAAGCTGGG - Intronic
1043594065 8:81863907-81863929 CCACCAAGCCAGGAGAAACTGGG + Intergenic
1044309184 8:90673873-90673895 CCCCAAACTCAGAAAAAGTTGGG - Intronic
1044632116 8:94290130-94290152 CCACAAACCATGAGGCAGCTGGG + Intergenic
1044909011 8:97036681-97036703 CCAGAAATCCAGTTGAAGCTAGG - Intronic
1045985506 8:108245351-108245373 CCTCAGCCCCAGAAGTAGCTGGG - Intronic
1046544869 8:115637192-115637214 CAAGAAACAGAGAAGAAGCTAGG + Intronic
1047000307 8:120566588-120566610 CCACAAACCCCTGAGAAGATGGG + Intronic
1047142252 8:122154355-122154377 GCACAAAACCAGCAGAAACTGGG - Intergenic
1047716190 8:127597371-127597393 CCAGCAAACCAGCAGAAGCTAGG + Intergenic
1048451663 8:134538679-134538701 CCTCAACCCCACAAGTAGCTGGG - Intronic
1049341212 8:142113594-142113616 CCACACACCCCGAAGATGCTCGG - Intergenic
1049480289 8:142819374-142819396 CCAGAAGCCCAGCAGAGGCTTGG - Intergenic
1050618793 9:7430838-7430860 ACACAAACCCTCAAGAAACTAGG - Intergenic
1055550657 9:77429439-77429461 CCACAAAAACAGAATAGGCTCGG - Intronic
1055915120 9:81392817-81392839 CCACAAACACTGAATAAGGTTGG + Intergenic
1056923223 9:90810268-90810290 CCACAAGCCAAGGAGATGCTGGG - Intronic
1057088892 9:92238224-92238246 TCAGTAACCCACAAGAAGCTAGG - Intronic
1057335951 9:94155508-94155530 ACACAGACCCAGGAGAATCTTGG - Intergenic
1058743256 9:107965558-107965580 ACACAGACCCAGGAGAAGCAGGG + Intergenic
1059514270 9:114878476-114878498 GCAGAAACCCAGAAGAACCGAGG + Intergenic
1060964501 9:127705211-127705233 ACACAAACCCTGCAGGAGCTGGG - Intronic
1061217394 9:129229653-129229675 CCACCACCCCAGAACAAGCCAGG - Intergenic
1062296867 9:135835243-135835265 CCACACACACAGCAGAAGCATGG + Intronic
1062450206 9:136612052-136612074 CCACAAAAACAGAAGAAATTCGG + Intergenic
1186075652 X:5875305-5875327 CCACAAGCCTGGAAGGAGCTAGG + Intronic
1186813937 X:13217072-13217094 TCAAAAGCCCAGAAGATGCTGGG + Intergenic
1189059448 X:37737647-37737669 CCTCAACCCCCTAAGAAGCTGGG + Intronic
1189501627 X:41566044-41566066 CTAAAAACTCAGAATAAGCTAGG + Intronic
1190444955 X:50514984-50515006 CCACCAACTCAGAAGAGGCAGGG + Intergenic
1190914869 X:54803885-54803907 CCATAAACTCTGAAGAACCTAGG - Intergenic
1191670112 X:63740948-63740970 CCACTAACCCAGGAGAGGATGGG + Intronic
1192695517 X:73411343-73411365 TCAGAAAACCAGAACAAGCTGGG - Intergenic
1192921295 X:75709498-75709520 ACACAAACCCAGCAGAAGAAAGG - Intergenic
1193011494 X:76680215-76680237 CCACAAAACTAGCAGAAGATGGG + Intergenic
1193405202 X:81092285-81092307 ACACAAACCCAGCAGAAGAAAGG + Intergenic
1194035407 X:88864424-88864446 CCACAAACCCACCAGAAGAAAGG + Intergenic
1196331975 X:114481756-114481778 CCAGAAAACCATAAGAAGCTAGG + Intergenic
1199596140 X:149507497-149507519 CCAGCAAACCACAAGAAGCTAGG + Intronic
1199696490 X:150346202-150346224 ACACAAAGACAGCAGAAGCTTGG - Intergenic
1199753750 X:150845600-150845622 CCCCAAAGCCAGAAGATGCAAGG + Intronic