ID: 932089457

View in Genome Browser
Species Human (GRCh38)
Location 2:68792002-68792024
Sequence TGCCTGCCTTACTAAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932089457_932089464 28 Left 932089457 2:68792002-68792024 CCTTCCTTTTAGTAAGGCAGGCA 0: 1
1: 0
2: 2
3: 8
4: 111
Right 932089464 2:68792053-68792075 CTGGTCCCTGTCCCGTCTCCAGG 0: 1
1: 0
2: 2
3: 21
4: 259
932089457_932089461 9 Left 932089457 2:68792002-68792024 CCTTCCTTTTAGTAAGGCAGGCA 0: 1
1: 0
2: 2
3: 8
4: 111
Right 932089461 2:68792034-68792056 TGGATCTCCACACTGAAACCTGG 0: 1
1: 0
2: 1
3: 14
4: 133
932089457_932089465 29 Left 932089457 2:68792002-68792024 CCTTCCTTTTAGTAAGGCAGGCA 0: 1
1: 0
2: 2
3: 8
4: 111
Right 932089465 2:68792054-68792076 TGGTCCCTGTCCCGTCTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932089457 Original CRISPR TGCCTGCCTTACTAAAAGGA AGG (reversed) Intronic