ID: 932089458

View in Genome Browser
Species Human (GRCh38)
Location 2:68792006-68792028
Sequence GGCATGCCTGCCTTACTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932089458_932089461 5 Left 932089458 2:68792006-68792028 CCTTTTAGTAAGGCAGGCATGCC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 932089461 2:68792034-68792056 TGGATCTCCACACTGAAACCTGG 0: 1
1: 0
2: 1
3: 14
4: 133
932089458_932089464 24 Left 932089458 2:68792006-68792028 CCTTTTAGTAAGGCAGGCATGCC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 932089464 2:68792053-68792075 CTGGTCCCTGTCCCGTCTCCAGG 0: 1
1: 0
2: 2
3: 21
4: 259
932089458_932089465 25 Left 932089458 2:68792006-68792028 CCTTTTAGTAAGGCAGGCATGCC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 932089465 2:68792054-68792076 TGGTCCCTGTCCCGTCTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932089458 Original CRISPR GGCATGCCTGCCTTACTAAA AGG (reversed) Intronic