ID: 932089460

View in Genome Browser
Species Human (GRCh38)
Location 2:68792027-68792049
Sequence TCAGTGTGGAGATCCAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932089460_932089464 3 Left 932089460 2:68792027-68792049 CCTTCTCTGGATCTCCACACTGA 0: 1
1: 0
2: 5
3: 20
4: 248
Right 932089464 2:68792053-68792075 CTGGTCCCTGTCCCGTCTCCAGG 0: 1
1: 0
2: 2
3: 21
4: 259
932089460_932089465 4 Left 932089460 2:68792027-68792049 CCTTCTCTGGATCTCCACACTGA 0: 1
1: 0
2: 5
3: 20
4: 248
Right 932089465 2:68792054-68792076 TGGTCCCTGTCCCGTCTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932089460 Original CRISPR TCAGTGTGGAGATCCAGAGA AGG (reversed) Intronic