ID: 932089462

View in Genome Browser
Species Human (GRCh38)
Location 2:68792041-68792063
Sequence ACAGGGACCAGGTTTCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932089462_932089465 -10 Left 932089462 2:68792041-68792063 CCACACTGAAACCTGGTCCCTGT 0: 1
1: 0
2: 1
3: 17
4: 199
Right 932089465 2:68792054-68792076 TGGTCCCTGTCCCGTCTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932089462 Original CRISPR ACAGGGACCAGGTTTCAGTG TGG (reversed) Intronic