ID: 932089465

View in Genome Browser
Species Human (GRCh38)
Location 2:68792054-68792076
Sequence TGGTCCCTGTCCCGTCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932089458_932089465 25 Left 932089458 2:68792006-68792028 CCTTTTAGTAAGGCAGGCATGCC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 932089465 2:68792054-68792076 TGGTCCCTGTCCCGTCTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 181
932089462_932089465 -10 Left 932089462 2:68792041-68792063 CCACACTGAAACCTGGTCCCTGT 0: 1
1: 0
2: 1
3: 17
4: 199
Right 932089465 2:68792054-68792076 TGGTCCCTGTCCCGTCTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 181
932089460_932089465 4 Left 932089460 2:68792027-68792049 CCTTCTCTGGATCTCCACACTGA 0: 1
1: 0
2: 5
3: 20
4: 248
Right 932089465 2:68792054-68792076 TGGTCCCTGTCCCGTCTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 181
932089457_932089465 29 Left 932089457 2:68792002-68792024 CCTTCCTTTTAGTAAGGCAGGCA 0: 1
1: 0
2: 2
3: 8
4: 111
Right 932089465 2:68792054-68792076 TGGTCCCTGTCCCGTCTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932089465 Original CRISPR TGGTCCCTGTCCCGTCTCCA GGG Intronic