ID: 932092322

View in Genome Browser
Species Human (GRCh38)
Location 2:68817486-68817508
Sequence TCCTCTCTGGAGACTTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 262}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932092313_932092322 11 Left 932092313 2:68817452-68817474 CCCCAGGCCTGAGATCTTCTTAC 0: 1
1: 0
2: 0
3: 13
4: 169
Right 932092322 2:68817486-68817508 TCCTCTCTGGAGACTTGGGTGGG 0: 1
1: 0
2: 0
3: 31
4: 262
932092312_932092322 20 Left 932092312 2:68817443-68817465 CCATGGATTCCCCAGGCCTGAGA 0: 1
1: 0
2: 1
3: 31
4: 311
Right 932092322 2:68817486-68817508 TCCTCTCTGGAGACTTGGGTGGG 0: 1
1: 0
2: 0
3: 31
4: 262
932092315_932092322 9 Left 932092315 2:68817454-68817476 CCAGGCCTGAGATCTTCTTACCA 0: 1
1: 0
2: 1
3: 15
4: 209
Right 932092322 2:68817486-68817508 TCCTCTCTGGAGACTTGGGTGGG 0: 1
1: 0
2: 0
3: 31
4: 262
932092314_932092322 10 Left 932092314 2:68817453-68817475 CCCAGGCCTGAGATCTTCTTACC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 932092322 2:68817486-68817508 TCCTCTCTGGAGACTTGGGTGGG 0: 1
1: 0
2: 0
3: 31
4: 262
932092316_932092322 4 Left 932092316 2:68817459-68817481 CCTGAGATCTTCTTACCAATAAA 0: 1
1: 0
2: 1
3: 10
4: 226
Right 932092322 2:68817486-68817508 TCCTCTCTGGAGACTTGGGTGGG 0: 1
1: 0
2: 0
3: 31
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932092322 Original CRISPR TCCTCTCTGGAGACTTGGGT GGG Intronic
901492682 1:9604551-9604573 TCCTCGCGGGGGACTTGGGATGG + Intronic
901836063 1:11925144-11925166 TCACCTCTGCAGACTTGGGAGGG + Intronic
902650088 1:17831485-17831507 TCCCCTCTGATGTCTTGGGTTGG + Intergenic
904446983 1:30581683-30581705 TCCTTGATGGAGATTTGGGTTGG + Intergenic
905270942 1:36787041-36787063 TCCACACTGGAGACTTAGGCAGG + Intergenic
906115292 1:43352574-43352596 TCCTCTCTGAGGACTTGGGGAGG - Exonic
907114827 1:51959398-51959420 TCCACTCTGGAGGCTGTGGTGGG + Intronic
907398604 1:54210008-54210030 TCCTCTCTGGAGGCGATGGTGGG - Exonic
908334191 1:63103637-63103659 TGCTCTCTGAATTCTTGGGTAGG + Intergenic
908510697 1:64848010-64848032 TCTTCTCTGGAGGCCTGGGGTGG - Intronic
909498689 1:76309283-76309305 TACTCTGTGTAGACTTGGCTAGG - Intronic
910568598 1:88675202-88675224 TCCTGTCTGGTGACTGGGCTGGG + Intergenic
912453161 1:109779899-109779921 TGCCCTCTGGACACTGGGGTAGG + Intergenic
913287222 1:117237576-117237598 TGCTCACTGCAGCCTTGGGTGGG - Intergenic
915285101 1:154847312-154847334 TCCTCTCTGGAGCCTGAGCTGGG + Intronic
916653458 1:166851611-166851633 TCCTCTCTGGAGGTGTAGGTGGG - Exonic
916659525 1:166908826-166908848 GCCTCCCTGAAGCCTTGGGTTGG + Exonic
919979132 1:202631495-202631517 TCCTCTCAGGGGACTTTGCTTGG - Intronic
920174475 1:204091598-204091620 CCATCTCTGTAGCCTTGGGTTGG + Intronic
920201885 1:204264702-204264724 TCCTCTCTTGGGGGTTGGGTGGG - Intronic
1065973584 10:30823860-30823882 TCTGCCCTGGAGACTTGGGGAGG - Intronic
1066552727 10:36577283-36577305 TCATCTTTTGAGACTTGGCTAGG - Intergenic
1067066329 10:43106062-43106084 TGCTCTCTGGGGACCTGGATGGG + Intronic
1071008802 10:80913615-80913637 GCTACTCTGGAGACTGGGGTAGG + Intergenic
1072540931 10:96397533-96397555 TCTTCTCTGGATACTTTGATGGG - Intronic
1074122690 10:110504850-110504872 TCCTCTCTGGATAATTGGTAAGG - Intronic
1074765587 10:116697580-116697602 TCCTAACTGGAGAGTGGGGTGGG - Intronic
1077333057 11:1991760-1991782 TCCTCTCTAGAGATGGGGGTGGG - Intergenic
1077545518 11:3167780-3167802 GCCATTCTGGAGACTTGGATTGG - Intergenic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1078194495 11:9124249-9124271 TCCTCTCAAGAGAGTTGGCTTGG - Intronic
1079383317 11:19957932-19957954 TCTTCTCAGGAAACTAGGGTTGG + Intronic
1080419877 11:32100339-32100361 TCTGCTCTGGAAACTGGGGTGGG + Intronic
1080455200 11:32412426-32412448 TATTCTCTGGGGACTCGGGTAGG - Intronic
1080809695 11:35691283-35691305 TCCTCTCTAGACACTTGGGCAGG + Intronic
1080830883 11:35892331-35892353 TCCTCTCTGAAGGCTTGGTGGGG - Intergenic
1082963481 11:58941439-58941461 TCATTTCTGGACATTTGGGTTGG + Intronic
1084659264 11:70537541-70537563 TCCTCCCCGGAGTCTTGGGATGG + Intronic
1084997723 11:72998428-72998450 GCCACTCAGGAGACTGGGGTGGG + Intronic
1085188709 11:74599142-74599164 TACTCTCAGGAGACTGAGGTGGG - Intronic
1087070278 11:94072906-94072928 TCTTTTCTGGGGACATGGGTGGG + Intronic
1087919525 11:103850300-103850322 TCCCCTCTAGAGACTTGACTAGG + Intergenic
1089068824 11:115682790-115682812 TCCTTTCTGGAGGCTTGGAGGGG - Intergenic
1090205994 11:124884754-124884776 AACTCTCTGGAGGCTTGGGAAGG + Exonic
1090248068 11:125230981-125231003 CCCTCTCTGGAGGATTGGTTTGG + Intronic
1202816040 11_KI270721v1_random:46938-46960 TCCTCTCTAGAGATGGGGGTGGG - Intergenic
1092549100 12:9478378-9478400 TGAACTCTGGAGACTTGGGAAGG + Intergenic
1093269535 12:17042380-17042402 TCCTTTTTGGAGATTTTGGTTGG - Intergenic
1094503895 12:31044089-31044111 TGAACTCTGGAGACTTGGGAAGG - Intergenic
1096576858 12:52558319-52558341 TCCTCTCAGCACTCTTGGGTCGG + Intergenic
1097036500 12:56128173-56128195 TCCTTTCTGGCGATTTGGGTTGG - Intronic
1097147503 12:56951843-56951865 TGCTCTCTGGAGATGTTGGTAGG - Exonic
1098042634 12:66367885-66367907 TCCTCTTTGTAGACATGGGAGGG - Intronic
1098998691 12:77151004-77151026 ATCTCTTTGGAGACCTGGGTGGG + Intergenic
1099524819 12:83706075-83706097 TCCTCTCTTGTGCCTGGGGTGGG + Intergenic
1099785019 12:87251122-87251144 TCATGTCTGGAAACTTGGGAAGG - Intergenic
1101078383 12:101154959-101154981 TCCACTCTGGGGACTGTGGTAGG + Intergenic
1101527294 12:105543084-105543106 TCTTATCTGGAGGCTTGAGTTGG + Intergenic
1102454698 12:113064169-113064191 TCCTCACTGGAGACTAGGGCTGG + Intronic
1102625317 12:114230810-114230832 TCTTATCTGGAGACTTGACTGGG + Intergenic
1102720836 12:115014544-115014566 TCCTCCCTGGAGCCTTCGGAGGG - Intergenic
1102728377 12:115086450-115086472 CCTTCTCTGTAGACTTGGGTGGG + Intergenic
1102728551 12:115087909-115087931 CCTTCTCTGTAGACTTGGGTGGG - Intergenic
1103236531 12:119377303-119377325 CCGTCTCTTGAGACTTGGGTTGG - Intronic
1103599157 12:122043367-122043389 GCCTCTCTGGACACATGGGATGG + Intronic
1103914150 12:124367973-124367995 TCCTTTCTGGCGGCCTGGGTGGG + Intronic
1105985043 13:25557599-25557621 TTCTCTCTGGAGACTTTGTGAGG + Intronic
1107295426 13:38902222-38902244 TGCTCCCTGGAGCCCTGGGTTGG - Intergenic
1109496713 13:63181121-63181143 TCCTTGCTGGATATTTGGGTTGG + Intergenic
1109629927 13:65033003-65033025 CCCTATCTGGGGACTGGGGTAGG - Intergenic
1110971263 13:81764760-81764782 TACTTGCTGAAGACTTGGGTGGG - Intergenic
1114798524 14:25743895-25743917 GCTTCTCTGGAGACTGAGGTGGG - Intergenic
1115870995 14:37802490-37802512 TCTCCTCTGGAAACTTGGCTGGG - Intronic
1116082984 14:40200100-40200122 TGTTAACTGGAGACTTGGGTGGG + Intergenic
1116104907 14:40489920-40489942 TCCTCTCTTCAGTCTTGGGGTGG - Intergenic
1118230726 14:63946314-63946336 GCTTCTCTGGAGACTGAGGTGGG + Intronic
1118364212 14:65080446-65080468 TCCTCTCTGGATACTGGAGATGG + Intronic
1118729982 14:68659285-68659307 TCCTCTCTGGAAGCTGGGGGAGG + Intronic
1119740720 14:77012251-77012273 TCCCCTCTGGACACCGGGGTTGG - Intergenic
1120158456 14:81119773-81119795 TCCTTGCTGGACATTTGGGTTGG - Intronic
1121916355 14:97839765-97839787 TCCTCTCTGGAGGTTAGAGTAGG - Intergenic
1122269669 14:100562993-100563015 CCCACGCGGGAGACTTGGGTGGG + Intronic
1124494734 15:30179452-30179474 TCCTCTCAGGGGACTTTGCTTGG - Intergenic
1124533607 15:30525777-30525799 TGCTCTCTGCAGACTTTGCTGGG + Intergenic
1124748835 15:32359193-32359215 TCCTCTCAGGGGACTTTGCTTGG + Intergenic
1124765048 15:32481868-32481890 TGCTCTCTGCAGACTTTGCTGGG - Intergenic
1125517899 15:40333074-40333096 TCCTGGCTGCAGAGTTGGGTGGG - Intronic
1126326952 15:47489243-47489265 TCCTCTCTGGAGTCTTTGGAGGG + Intronic
1126875033 15:53032281-53032303 TCCGCTCTGGGGGCCTGGGTGGG + Intergenic
1127994416 15:64144763-64144785 TCCTCTGAGCAGCCTTGGGTGGG - Intronic
1129056579 15:72824529-72824551 TGCTCTCTGGAGAGATGGGGAGG - Intergenic
1131779716 15:95843357-95843379 TCCTCTCTGGGGAGATGGTTTGG - Intergenic
1132576375 16:666229-666251 TCCTCTCTGGAGACAAGGATGGG + Exonic
1135227622 16:20675104-20675126 ACCTCTCTGGTGTCCTGGGTAGG - Intronic
1136222525 16:28837251-28837273 TCCTCCTTGGAGACTAGAGTGGG + Intergenic
1136465588 16:30441348-30441370 GCTTCTCTGGAGGCTGGGGTGGG - Intergenic
1137001419 16:35233734-35233756 TCCTGTCTGGACTCGTGGGTAGG + Intergenic
1137848014 16:51710812-51710834 TTCTCTCCGGAGAGTTGGGCAGG - Intergenic
1139454304 16:67060085-67060107 TACTCTCTGCAGACTGAGGTGGG - Intronic
1142050895 16:87957477-87957499 TCCTGTCAGGAGACCTGGGGCGG + Intronic
1142170895 16:88622281-88622303 TCTTCTTGGGAGACTTGGATCGG - Exonic
1142873778 17:2838471-2838493 TGCTCTTTGGAGAGTTGGGATGG + Intronic
1144058757 17:11562865-11562887 TCCTCACTAGAGCCTGGGGTGGG + Exonic
1144124594 17:12190593-12190615 TTATCTCTGGAGACTTTAGTTGG + Intergenic
1146896337 17:36544828-36544850 TCCTCTCGCGAGACTGGGGCTGG - Intergenic
1148026678 17:44593598-44593620 TCCTCTCTGGGGCCTTGGGCAGG - Intergenic
1148929545 17:51117278-51117300 ACCTCTGTGGAAACTTAGGTGGG - Intronic
1150301514 17:64050924-64050946 TCCCCGATGGAGACCTGGGTGGG - Intronic
1151904666 17:77039848-77039870 ACCCCTCTGGAGACTTTGGTAGG - Intergenic
1152756873 17:82090668-82090690 TCCTATCAGGAGACCTGGGAGGG - Intronic
1152901316 17:82942625-82942647 TGCGCTCTGGTGACTTGGGGTGG + Exonic
1153721332 18:7906310-7906332 ACCTCCCTGAAGACTGGGGTGGG + Intronic
1154190978 18:12231081-12231103 TCGTCTCTTGAGAATTGGCTTGG + Intergenic
1154361345 18:13664613-13664635 TGCTCTCTGCAGTCTTGGGCAGG - Exonic
1155797544 18:30059294-30059316 CTCTCCCTGGAGCCTTGGGTGGG - Intergenic
1157300423 18:46474946-46474968 CCCACTCTGGAGACATGGCTGGG + Intergenic
1157326765 18:46674753-46674775 TCCCCTCTAGAGACCTGGGCTGG - Intronic
1158319236 18:56245141-56245163 TTCTCCCTGGACACTTGGGTAGG - Intergenic
1158604427 18:58882734-58882756 TTCTCTTTGGAGACTGGGGATGG - Intronic
1159820926 18:73142769-73142791 GCCACTCTGGAGACTGAGGTGGG - Intergenic
1163189266 19:15664405-15664427 TCCTAGCTGCAGACTTGGGGTGG + Intergenic
1163287614 19:16358264-16358286 TCCACTGTGGAGACTTGCATTGG + Intronic
1168097229 19:54122779-54122801 CCCTCTCGGGAGACTGGGGTTGG - Intronic
1168139984 19:54379498-54379520 TCGTTTCTGGAGTTTTGGGTGGG + Intergenic
1168198131 19:54790858-54790880 TCTTCTCTGGGGACTCGGGGAGG + Intronic
1168299331 19:55394681-55394703 GCCTCTCTGGAGACTGAGGTGGG - Intronic
1168410047 19:56134141-56134163 TCATCTCTGGAGGCTCGGGTTGG - Intronic
926116579 2:10217477-10217499 TCTTCCCAGGAGAGTTGGGTGGG - Intergenic
926308356 2:11656836-11656858 ACCTCTCTGGAGCGTTGGCTGGG + Intergenic
927145522 2:20163016-20163038 TCATCACTGGAGATTTGGGGTGG + Intergenic
927435582 2:23063617-23063639 GCTTCTCTGGATACTTGTGTTGG - Intergenic
928241799 2:29592895-29592917 TTCTCCCTGGAGTCTTGGGAGGG + Intronic
928649607 2:33390597-33390619 GCTTCTCGGGAGACTGGGGTGGG - Intronic
931461202 2:62451759-62451781 TCTTATCTGGACACTTGGGAGGG - Intergenic
931818776 2:65930902-65930924 TCCTCTATGGTGACTTTGGGAGG + Intergenic
931919908 2:67003828-67003850 TCTTCTCTGGAGACTGGCCTTGG - Intergenic
932092322 2:68817486-68817508 TCCTCTCTGGAGACTTGGGTGGG + Intronic
933287736 2:80402386-80402408 ACCTCTCTGGAGGTTGGGGTGGG + Intronic
933760697 2:85670066-85670088 GCTACTCTGGAGACTTAGGTGGG - Intergenic
934704155 2:96464691-96464713 TTCTCTCTGAAGACTTGACTGGG + Intergenic
934913477 2:98279360-98279382 TCCTCGCTGGAGATTCGGCTGGG + Intronic
935155937 2:100483602-100483624 TTCTCCCTGGAGATTGGGGTTGG - Intergenic
936284607 2:111172692-111172714 TCCTGTCTGGACACTTGGGGTGG - Intergenic
936808848 2:116371597-116371619 TTCTCTCTGGAGCCTTGGGAGGG + Intergenic
944746763 2:202664997-202665019 TTTTATCTGGAGACTTTGGTGGG + Intronic
945365828 2:208952497-208952519 TCCTCTCTGGAAATATGGCTGGG + Intergenic
945425619 2:209696709-209696731 TCATCTCTGGAGACTGTGCTAGG - Exonic
946036228 2:216744541-216744563 TCCTCTATGGACAGTTGGGTGGG + Intergenic
946090307 2:217216615-217216637 TCCTCTCTGAAGATTTTTGTAGG + Intergenic
946529581 2:220557493-220557515 TACTGTCTGGAGAATTGGGGTGG - Intergenic
946869454 2:224072715-224072737 TCCTCTCTGGAGAAATGGATTGG + Intergenic
947440830 2:230120154-230120176 TGCTGTCTGGAGCCTTTGGTAGG + Intergenic
947510162 2:230745464-230745486 TGCACTCCGGAGACTTGGTTGGG + Intronic
947684512 2:232071037-232071059 TCCTCTATGCAGACCTGGCTTGG - Intronic
947771683 2:232675427-232675449 TCCTCTCTGGGCACCTGGTTGGG + Intronic
947837670 2:233187479-233187501 TTCTCTCCTGAGACTGGGGTAGG + Intronic
1169169630 20:3454362-3454384 TCTACTCAGGAGACTGGGGTGGG - Intergenic
1171964758 20:31521249-31521271 TCCTATCTGGAAATTTCGGTTGG - Intronic
1172082779 20:32355903-32355925 TCCTTTCTAGAGAGTTGGGGAGG + Intergenic
1172828136 20:37807657-37807679 TCCTCTTTTGTGACTTGGGGTGG + Intronic
1172921478 20:38486447-38486469 TCCTCTCTTCAGAATTGGGAGGG + Intronic
1173218250 20:41108440-41108462 CCCTTTCTGGAAACTTGGATTGG + Intronic
1174052661 20:47778158-47778180 TCTTCTCTGGCTACTGGGGTGGG + Intronic
1174123629 20:48286810-48286832 TCCTCTCTGAAGACTGCTGTGGG - Intergenic
1175302882 20:57955447-57955469 TCCTCACCGCAGACCTGGGTAGG - Intergenic
1175402233 20:58707299-58707321 TCCGCTGGGGAGACTCGGGTAGG - Intronic
1175430466 20:58898683-58898705 AGCTCTCTGGAGACTCTGGTCGG - Intronic
1176277400 20:64280125-64280147 GCCTCTGGGGAGCCTTGGGTTGG + Intronic
1176389635 21:6156926-6156948 TCCTCTCTGGGGACTGGGGGTGG - Intergenic
1177461665 21:21419757-21419779 TCATTGCTGGACACTTGGGTTGG + Intronic
1178787458 21:35667080-35667102 CCCTCTGTGTAGACTTGAGTAGG + Intronic
1178833763 21:36078706-36078728 TTCTCTCTAGAGACTTTGGAGGG + Intronic
1178896441 21:36562535-36562557 TCAACTCTGGAGACTTGGTGGGG - Intronic
1178943396 21:36926121-36926143 TCCTCTCTGCAGATGTTGGTGGG - Intronic
1179628959 21:42665207-42665229 TCCTCCCTGGAGTCCTGGGAAGG + Intronic
1179733833 21:43381312-43381334 TCCTCTCTGGGGACTGGGGGTGG + Intergenic
1179900269 21:44389012-44389034 TCCTGTATGGAGACTGTGGTGGG - Intronic
1180910935 22:19449454-19449476 TCCTCTCTGGAGTGTTGGAGGGG + Intergenic
1182172010 22:28240572-28240594 TCCTCTCTGGAGACTAAGCTAGG - Intronic
1184254107 22:43277287-43277309 TCCTCTCAGGAGCCATGGGAAGG + Intronic
1184562565 22:45271897-45271919 TCGCCTCTGGGGTCTTGGGTAGG - Intergenic
1185161086 22:49230266-49230288 TCCTCCTTGGAGACCTGAGTGGG - Intergenic
1185317245 22:50184511-50184533 TCCTCTCTGGAGCCACGGGGAGG - Intergenic
951416199 3:22424985-22425007 TCCTCTTTGGATACCTGAGTTGG - Intergenic
953184587 3:40626206-40626228 TCCTCTGTGGAGTCCTGGGGAGG + Intergenic
953584884 3:44190428-44190450 GCCTCTCAGGAGACTAGGGCTGG + Intergenic
955055110 3:55447839-55447861 CCATCACTAGAGACTTGGGTAGG - Intergenic
955215483 3:56981941-56981963 CCATCTCTGGAGCCTGGGGTTGG - Intronic
955767447 3:62359796-62359818 TTCCATCTGGAGACTTGGCTGGG + Intergenic
960036215 3:113105322-113105344 TTCTCTCTGGTGCCTTGGGCAGG - Intergenic
960449883 3:117793566-117793588 TCCTCTTTGGAGACTTGTGGAGG - Intergenic
961022202 3:123517646-123517668 TCCCCTCTGGAGTGTTGGGTGGG - Intronic
961375938 3:126465837-126465859 GCTACTCTGGAGACTGGGGTGGG + Intronic
961554755 3:127690322-127690344 TGCTCTGTGGGGACTTGGGCCGG + Exonic
962358527 3:134715544-134715566 TCCTCTCTCTAGACTGGGTTGGG + Intronic
963601723 3:147384707-147384729 TCCTCTCTGGAGCCATGGGCAGG + Intergenic
966287925 3:178319647-178319669 TCCTCCCTGTAGCCCTGGGTGGG + Intergenic
966896746 3:184450649-184450671 TGCTCTCTGGAGCCTTTGGCAGG - Intronic
967899445 3:194434506-194434528 TGCTCTCAAGACACTTGGGTGGG + Intronic
968111010 3:196046701-196046723 TACTCTCAGGAGGCTTAGGTAGG + Intronic
969128410 4:4971900-4971922 TCCTTTCTGGAGGTTGGGGTTGG + Intergenic
969575412 4:8033623-8033645 CCCTCTGGGGAGACCTGGGTTGG - Intronic
969671931 4:8594405-8594427 TCCTCACTGGAGCCTGGGGACGG + Intronic
969854424 4:9987714-9987736 GCCTCTCGGGAGACTGGGGCAGG + Intronic
969906459 4:10401231-10401253 AGCTCTCTGGGGACTGGGGTGGG + Intergenic
971159771 4:24121684-24121706 TCCTCTCTGCAGCCTTACGTGGG + Intergenic
973346400 4:49060369-49060391 GCCAGTCTGGAGCCTTGGGTGGG + Intronic
973579824 4:52332055-52332077 TGCTCTCTTAAAACTTGGGTTGG - Intergenic
973865182 4:55105801-55105823 TCTTCTCTGGAGGTTTGGGTTGG - Intronic
976876692 4:89862065-89862087 ACCTGACTGGAAACTTGGGTGGG - Intergenic
981559901 4:146036172-146036194 TGGTCTCTGGGGACTTGGGGGGG + Intergenic
982422425 4:155212874-155212896 TGCTCTAAGGAAACTTGGGTTGG - Intronic
982923795 4:161309421-161309443 TACTCCCTTGAGACTTGAGTAGG + Intergenic
983028043 4:162761291-162761313 TCTTCTCTGCAGCCTTGTGTGGG - Intergenic
983738113 4:171089430-171089452 TCCTCTCTGGCTACCTGGGAGGG - Intergenic
985562233 5:594142-594164 TCCTCCCTGGAGCCTTTGGAGGG - Intergenic
985875187 5:2589022-2589044 GCCTCTGTGTACACTTGGGTGGG + Intergenic
986024593 5:3838730-3838752 TCCTCTCTGGAGCCTCTGCTGGG + Intergenic
986583625 5:9291954-9291976 TCCTGTATGGAGACTTGGGATGG - Intronic
988141994 5:27254997-27255019 TCCTCGTTGGACATTTGGGTTGG - Intergenic
988690406 5:33566350-33566372 TCTACTCAGGAGACTTAGGTGGG + Intronic
989646104 5:43634169-43634191 ATGTCTCTGGAGAATTGGGTGGG + Intronic
995928484 5:117406182-117406204 TCCTCTCTGGAGAATGTGCTAGG - Intergenic
997360428 5:133291290-133291312 TCATGTCTGGAGGCGTGGGTGGG + Intronic
998406812 5:141878695-141878717 TCCTAGATGGAGGCTTGGGTGGG - Intronic
998554480 5:143109804-143109826 TCCTCTCTGTAGACTCGGAAAGG - Intronic
1000209241 5:159095849-159095871 ACCTCTCTGGACACTGGGGAAGG - Intronic
1001964989 5:175903737-175903759 TCCTCTCTGGGGACCAGGGCTGG + Intergenic
1002251967 5:177935451-177935473 TCCTCTCTGGGGACCAGGGCTGG - Intergenic
1003974673 6:11331040-11331062 CCCTCTCTAGAAACATGGGTAGG - Intronic
1004497623 6:16179887-16179909 TCGTCTCTGTAGACTTGAATTGG - Intergenic
1006937690 6:37729783-37729805 TCCTCCCTGGAGCCTTTGGAGGG - Intergenic
1007089989 6:39178032-39178054 TCGCCTCTGGGGACTGGGGTTGG + Intergenic
1008135823 6:47775646-47775668 ACCCCTCTGGAGACCTGGATTGG + Intergenic
1008522152 6:52372461-52372483 GCCTCTCTAGAAACATGGGTGGG - Intronic
1011439698 6:87374415-87374437 GCTACTCTGGAGACTGGGGTGGG + Intronic
1012277954 6:97296391-97296413 GCTCCTCTGGAGACTGGGGTGGG + Intergenic
1013054491 6:106570222-106570244 TCTTCTCTGGAGTCTATGGTAGG + Exonic
1013406653 6:109849702-109849724 TCCTCTTTGGAGCCTTTGGCAGG + Intergenic
1013809811 6:114032040-114032062 GCCTCTCTGGAGGCTGAGGTGGG - Intergenic
1013834304 6:114314641-114314663 TCCTCTCTGGAGATATGGCCAGG + Intronic
1018352494 6:162975133-162975155 TCCTGTCTGGATACCTTGGTAGG - Intronic
1018950101 6:168373475-168373497 TCCTCCCTGGAGACAGAGGTGGG + Intergenic
1020020442 7:4863663-4863685 TTCTCTCTCTTGACTTGGGTGGG - Intronic
1020058151 7:5132801-5132823 GCTTCTCTGGAGGCTGGGGTGGG - Intergenic
1020238657 7:6375155-6375177 TCCCCTTTTGAGAATTGGGTTGG + Intronic
1021528915 7:21620961-21620983 TCCTCGTTGGACATTTGGGTTGG + Intronic
1021801019 7:24306476-24306498 TGCACTGAGGAGACTTGGGTGGG - Intergenic
1024115700 7:46191124-46191146 TCTTCTCTTGAGAATTTGGTTGG - Intergenic
1028928282 7:96384350-96384372 TGCTTCCAGGAGACTTGGGTTGG - Intergenic
1031203051 7:118716024-118716046 TCCTCTCTGGATACTTGGTGTGG - Intergenic
1034125121 7:148664433-148664455 TTCTCTCTGGAGACCGGGCTGGG - Intergenic
1035144090 7:156795662-156795684 GCCCCTCTGGAGACTAAGGTGGG - Intronic
1035145536 7:156811866-156811888 TCTTCCCTGGAGACTTTGGAAGG - Intronic
1036179709 8:6573749-6573771 TCTGCTCTGGAGAGTGGGGTGGG - Intronic
1036649849 8:10635208-10635230 TCCCCTCTGGAAACTGGGGGAGG + Intronic
1037958793 8:23080592-23080614 TCCTCTGTTGAGACTTCTGTTGG + Intergenic
1038235167 8:25745912-25745934 TCCTTCCTGGAGCCCTGGGTGGG - Intergenic
1039093424 8:33857211-33857233 CTCTCTCAGGAGATTTGGGTGGG - Intergenic
1039372268 8:36997151-36997173 TTTTATCTGGAGACTTGGATGGG - Intergenic
1039929401 8:41970816-41970838 TCATTTCTGGACATTTGGGTTGG - Intronic
1040587549 8:48757613-48757635 AGCTCTCTGGACACATGGGTGGG - Intergenic
1041157051 8:54998386-54998408 ACTACTCTGGAGGCTTGGGTGGG + Intergenic
1041159731 8:55027267-55027289 GCCTCCCTGGAGGCTTGGGCTGG - Intergenic
1041513335 8:58674624-58674646 TCCACTCTAGAGACTGAGGTGGG - Intergenic
1041614310 8:59887592-59887614 TCCTTGTTGGACACTTGGGTTGG - Intergenic
1043075818 8:75698223-75698245 CAGTCTCTGGAGACTTGGCTGGG + Intergenic
1043908460 8:85833454-85833476 TCTACTCTGGAGACTGAGGTGGG - Intergenic
1044277028 8:90313147-90313169 TTCTTTCTGGAGACTTAGGGAGG - Intergenic
1044751388 8:95419588-95419610 TCCTCTCTGTGGAGTTGGGGTGG + Intergenic
1048018885 8:130520229-130520251 TCCTCTCTGCAGCCTGGGGTGGG + Intergenic
1049411625 8:142476232-142476254 TCCTCTCAGGAGCCTGGGGAGGG + Intronic
1049599996 8:143503309-143503331 TCATGTGTGGAGACTGGGGTGGG - Intronic
1053138331 9:35665498-35665520 TCCTATCTGGAGAATTGGGACGG + Intronic
1053449175 9:38179126-38179148 TCCTTCCTAGAGACTTGGGGAGG + Intergenic
1056943940 9:90977879-90977901 TCTCCTCTGGAGCCTGGGGTGGG - Intergenic
1059257178 9:112941504-112941526 TCTACTCTGGAGACTGAGGTGGG + Intergenic
1059872271 9:118591022-118591044 TCTACTCTGGAGACTGAGGTAGG - Intergenic
1060121709 9:120997581-120997603 TTTTCACTGGAGACTTGGTTTGG - Exonic
1060668350 9:125447084-125447106 GCCTTTCAGGAGACTTGGCTTGG - Intronic
1060839703 9:126783811-126783833 TTCTCTCTGGACACCTGGCTGGG - Intergenic
1061090049 9:128421213-128421235 TCCTCTCTGGCGGCTCGGGCTGG - Intronic
1061258826 9:129467925-129467947 ACCTCGGTGGAGCCTTGGGTGGG - Intergenic
1061601736 9:131674904-131674926 CCCTCTCTCCAGACTTGGTTAGG - Intronic
1061968998 9:134033702-134033724 TTCTCTGTGGAGACATGGGCAGG + Exonic
1062437889 9:136554719-136554741 TCCTCCCTAGAGCCTTGGGAGGG + Intergenic
1185925322 X:4139584-4139606 GTCTTTCTGGAGACTTTGGTGGG + Intergenic
1187127550 X:16468505-16468527 TCCTCCCTACAGACTTGGGAGGG - Intergenic
1189944650 X:46165584-46165606 TCCACTCTGGAGAAATGGGATGG - Intergenic
1190336679 X:49266930-49266952 TGCTCCCTGCAGACTTGGGTCGG + Intergenic
1190391792 X:49939382-49939404 TCATTGCTGGACACTTGGGTTGG - Intronic
1190392166 X:49942801-49942823 TCATTGCTGGACACTTGGGTTGG + Intronic
1192986796 X:76408473-76408495 ACCTCTTTGGAGACCTGGGAGGG + Intergenic
1200171038 X:154074983-154075005 TCCTCACTGGGCTCTTGGGTTGG - Intronic