ID: 932094928

View in Genome Browser
Species Human (GRCh38)
Location 2:68839174-68839196
Sequence GCAGGAGGGAAGTTTAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932094928_932094939 26 Left 932094928 2:68839174-68839196 CCAGCTTTAAACTTCCCTCCTGC No data
Right 932094939 2:68839223-68839245 GAAAGGATGTTCCTAAGTCCTGG No data
932094928_932094934 -6 Left 932094928 2:68839174-68839196 CCAGCTTTAAACTTCCCTCCTGC No data
Right 932094934 2:68839191-68839213 TCCTGCTAACTGAGGCTTTGGGG No data
932094928_932094937 9 Left 932094928 2:68839174-68839196 CCAGCTTTAAACTTCCCTCCTGC No data
Right 932094937 2:68839206-68839228 CTTTGGGGGCCAACAATGAAAGG No data
932094928_932094936 -5 Left 932094928 2:68839174-68839196 CCAGCTTTAAACTTCCCTCCTGC No data
Right 932094936 2:68839192-68839214 CCTGCTAACTGAGGCTTTGGGGG No data
932094928_932094933 -7 Left 932094928 2:68839174-68839196 CCAGCTTTAAACTTCCCTCCTGC No data
Right 932094933 2:68839190-68839212 CTCCTGCTAACTGAGGCTTTGGG No data
932094928_932094940 29 Left 932094928 2:68839174-68839196 CCAGCTTTAAACTTCCCTCCTGC No data
Right 932094940 2:68839226-68839248 AGGATGTTCCTAAGTCCTGGAGG No data
932094928_932094932 -8 Left 932094928 2:68839174-68839196 CCAGCTTTAAACTTCCCTCCTGC No data
Right 932094932 2:68839189-68839211 CCTCCTGCTAACTGAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932094928 Original CRISPR GCAGGAGGGAAGTTTAAAGC TGG (reversed) Intergenic
No off target data available for this crispr