ID: 932096103

View in Genome Browser
Species Human (GRCh38)
Location 2:68850277-68850299
Sequence GGAACACACATTATTAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932096103_932096104 -5 Left 932096103 2:68850277-68850299 CCACATTTAATAATGTGTGTTCC No data
Right 932096104 2:68850295-68850317 GTTCCAATCCTCCAAATTTCTGG No data
932096103_932096111 29 Left 932096103 2:68850277-68850299 CCACATTTAATAATGTGTGTTCC No data
Right 932096111 2:68850329-68850351 TGTTGGACTCTACTAGGCTTTGG No data
932096103_932096110 23 Left 932096103 2:68850277-68850299 CCACATTTAATAATGTGTGTTCC No data
Right 932096110 2:68850323-68850345 CAGCTCTGTTGGACTCTACTAGG No data
932096103_932096112 30 Left 932096103 2:68850277-68850299 CCACATTTAATAATGTGTGTTCC No data
Right 932096112 2:68850330-68850352 GTTGGACTCTACTAGGCTTTGGG No data
932096103_932096108 12 Left 932096103 2:68850277-68850299 CCACATTTAATAATGTGTGTTCC No data
Right 932096108 2:68850312-68850334 TTCTGGTGTGCCAGCTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932096103 Original CRISPR GGAACACACATTATTAAATG TGG (reversed) Intergenic
No off target data available for this crispr