ID: 932096105

View in Genome Browser
Species Human (GRCh38)
Location 2:68850298-68850320
Sequence ACACCAGAAATTTGGAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932096105_932096112 9 Left 932096105 2:68850298-68850320 CCAATCCTCCAAATTTCTGGTGT No data
Right 932096112 2:68850330-68850352 GTTGGACTCTACTAGGCTTTGGG No data
932096105_932096111 8 Left 932096105 2:68850298-68850320 CCAATCCTCCAAATTTCTGGTGT No data
Right 932096111 2:68850329-68850351 TGTTGGACTCTACTAGGCTTTGG No data
932096105_932096113 30 Left 932096105 2:68850298-68850320 CCAATCCTCCAAATTTCTGGTGT No data
Right 932096113 2:68850351-68850373 GGAAATGTCTTTGCCTTCACTGG No data
932096105_932096108 -9 Left 932096105 2:68850298-68850320 CCAATCCTCCAAATTTCTGGTGT No data
Right 932096108 2:68850312-68850334 TTCTGGTGTGCCAGCTCTGTTGG No data
932096105_932096110 2 Left 932096105 2:68850298-68850320 CCAATCCTCCAAATTTCTGGTGT No data
Right 932096110 2:68850323-68850345 CAGCTCTGTTGGACTCTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932096105 Original CRISPR ACACCAGAAATTTGGAGGAT TGG (reversed) Intergenic
No off target data available for this crispr