ID: 932096106

View in Genome Browser
Species Human (GRCh38)
Location 2:68850303-68850325
Sequence CTGGCACACCAGAAATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932096106_932096113 25 Left 932096106 2:68850303-68850325 CCTCCAAATTTCTGGTGTGCCAG No data
Right 932096113 2:68850351-68850373 GGAAATGTCTTTGCCTTCACTGG No data
932096106_932096114 26 Left 932096106 2:68850303-68850325 CCTCCAAATTTCTGGTGTGCCAG No data
Right 932096114 2:68850352-68850374 GAAATGTCTTTGCCTTCACTGGG No data
932096106_932096112 4 Left 932096106 2:68850303-68850325 CCTCCAAATTTCTGGTGTGCCAG No data
Right 932096112 2:68850330-68850352 GTTGGACTCTACTAGGCTTTGGG No data
932096106_932096110 -3 Left 932096106 2:68850303-68850325 CCTCCAAATTTCTGGTGTGCCAG No data
Right 932096110 2:68850323-68850345 CAGCTCTGTTGGACTCTACTAGG No data
932096106_932096111 3 Left 932096106 2:68850303-68850325 CCTCCAAATTTCTGGTGTGCCAG No data
Right 932096111 2:68850329-68850351 TGTTGGACTCTACTAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932096106 Original CRISPR CTGGCACACCAGAAATTTGG AGG (reversed) Intergenic
No off target data available for this crispr