ID: 932096110

View in Genome Browser
Species Human (GRCh38)
Location 2:68850323-68850345
Sequence CAGCTCTGTTGGACTCTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932096107_932096110 -6 Left 932096107 2:68850306-68850328 CCAAATTTCTGGTGTGCCAGCTC No data
Right 932096110 2:68850323-68850345 CAGCTCTGTTGGACTCTACTAGG No data
932096106_932096110 -3 Left 932096106 2:68850303-68850325 CCTCCAAATTTCTGGTGTGCCAG No data
Right 932096110 2:68850323-68850345 CAGCTCTGTTGGACTCTACTAGG No data
932096103_932096110 23 Left 932096103 2:68850277-68850299 CCACATTTAATAATGTGTGTTCC No data
Right 932096110 2:68850323-68850345 CAGCTCTGTTGGACTCTACTAGG No data
932096105_932096110 2 Left 932096105 2:68850298-68850320 CCAATCCTCCAAATTTCTGGTGT No data
Right 932096110 2:68850323-68850345 CAGCTCTGTTGGACTCTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932096110 Original CRISPR CAGCTCTGTTGGACTCTACT AGG Intergenic
No off target data available for this crispr