ID: 932096111

View in Genome Browser
Species Human (GRCh38)
Location 2:68850329-68850351
Sequence TGTTGGACTCTACTAGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932096105_932096111 8 Left 932096105 2:68850298-68850320 CCAATCCTCCAAATTTCTGGTGT No data
Right 932096111 2:68850329-68850351 TGTTGGACTCTACTAGGCTTTGG No data
932096107_932096111 0 Left 932096107 2:68850306-68850328 CCAAATTTCTGGTGTGCCAGCTC No data
Right 932096111 2:68850329-68850351 TGTTGGACTCTACTAGGCTTTGG No data
932096106_932096111 3 Left 932096106 2:68850303-68850325 CCTCCAAATTTCTGGTGTGCCAG No data
Right 932096111 2:68850329-68850351 TGTTGGACTCTACTAGGCTTTGG No data
932096103_932096111 29 Left 932096103 2:68850277-68850299 CCACATTTAATAATGTGTGTTCC No data
Right 932096111 2:68850329-68850351 TGTTGGACTCTACTAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932096111 Original CRISPR TGTTGGACTCTACTAGGCTT TGG Intergenic
No off target data available for this crispr