ID: 932096113

View in Genome Browser
Species Human (GRCh38)
Location 2:68850351-68850373
Sequence GGAAATGTCTTTGCCTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932096107_932096113 22 Left 932096107 2:68850306-68850328 CCAAATTTCTGGTGTGCCAGCTC No data
Right 932096113 2:68850351-68850373 GGAAATGTCTTTGCCTTCACTGG No data
932096106_932096113 25 Left 932096106 2:68850303-68850325 CCTCCAAATTTCTGGTGTGCCAG No data
Right 932096113 2:68850351-68850373 GGAAATGTCTTTGCCTTCACTGG No data
932096105_932096113 30 Left 932096105 2:68850298-68850320 CCAATCCTCCAAATTTCTGGTGT No data
Right 932096113 2:68850351-68850373 GGAAATGTCTTTGCCTTCACTGG No data
932096109_932096113 6 Left 932096109 2:68850322-68850344 CCAGCTCTGTTGGACTCTACTAG No data
Right 932096113 2:68850351-68850373 GGAAATGTCTTTGCCTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932096113 Original CRISPR GGAAATGTCTTTGCCTTCAC TGG Intergenic
No off target data available for this crispr