ID: 932097444

View in Genome Browser
Species Human (GRCh38)
Location 2:68864088-68864110
Sequence TCTGCACAGGAAGGGTCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 10, 3: 60, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932097444_932097453 20 Left 932097444 2:68864088-68864110 CCACCGGACCCTTCCTGTGCAGA 0: 1
1: 0
2: 10
3: 60
4: 231
Right 932097453 2:68864131-68864153 GTCCTGGCCAGTTGCAAAATGGG 0: 1
1: 0
2: 0
3: 2
4: 83
932097444_932097449 4 Left 932097444 2:68864088-68864110 CCACCGGACCCTTCCTGTGCAGA 0: 1
1: 0
2: 10
3: 60
4: 231
Right 932097449 2:68864115-68864137 TTCCTCACCACTTTCAGTCCTGG 0: 1
1: 0
2: 2
3: 17
4: 186
932097444_932097456 27 Left 932097444 2:68864088-68864110 CCACCGGACCCTTCCTGTGCAGA 0: 1
1: 0
2: 10
3: 60
4: 231
Right 932097456 2:68864138-68864160 CCAGTTGCAAAATGGGAAGATGG 0: 1
1: 0
2: 2
3: 35
4: 342
932097444_932097452 19 Left 932097444 2:68864088-68864110 CCACCGGACCCTTCCTGTGCAGA 0: 1
1: 0
2: 10
3: 60
4: 231
Right 932097452 2:68864130-68864152 AGTCCTGGCCAGTTGCAAAATGG 0: 1
1: 0
2: 0
3: 6
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932097444 Original CRISPR TCTGCACAGGAAGGGTCCGG TGG (reversed) Intergenic
900467155 1:2831377-2831399 TCTTCCCAGGAAGGGCCCGGTGG + Intergenic
900528641 1:3141874-3141896 TCCGCACAGAACGGGTCAGGTGG - Intronic
903368138 1:22817500-22817522 TCTGAACAGGAAGGAGCCTGTGG - Intronic
904000218 1:27334661-27334683 TCTGCCTAGGAAGGGACCTGTGG - Intronic
904167335 1:28566027-28566049 TCAGCACAGGCTGGGTGCGGTGG + Intronic
905773701 1:40654376-40654398 TGTGCCCTGAAAGGGTCCGGGGG - Intronic
907479733 1:54737121-54737143 CCTGCACAGGAAGCTCCCGGGGG - Intronic
909267375 1:73577551-73577573 TCTGCACAGGATGGGTGGGCTGG - Intergenic
910676600 1:89821760-89821782 CCTGCACAGGAAGGAAGCGGAGG - Intronic
912075707 1:105873060-105873082 TCTGCACAGGATGGATGGGGTGG + Intergenic
912075742 1:105873285-105873307 TCTGAACAGGAAGGGTTGGTGGG + Intergenic
914689426 1:150012224-150012246 ACTGAACTGGAAGGGTACGGGGG + Intergenic
915090219 1:153419022-153419044 TCTGCACAGGCATGGTCGTGGGG - Intronic
915310827 1:155005099-155005121 CCTGCCCAGGGAGGGTGCGGCGG + Intronic
915318016 1:155040633-155040655 TCTGCACAGGCAGAGCCTGGGGG + Intronic
917821583 1:178768959-178768981 TCTGCACAGGAATGGTAGGGTGG + Intronic
918925644 1:190782340-190782362 TCTGCACATGAAGGGTGTGGAGG - Intergenic
919593874 1:199537911-199537933 TCTGCACAGGAAGGGTGGAGTGG - Intergenic
919848291 1:201655432-201655454 CATGCACAGGAAGGGCCGGGTGG + Intronic
920732066 1:208496814-208496836 TCTGCACAGGAAGGGTGGAGTGG + Intergenic
920748780 1:208654368-208654390 TCTGGAAAGGAAGGTTCAGGAGG + Intergenic
922062296 1:222104225-222104247 GCTGCACAGCAAGGGTCCATAGG + Intergenic
922068840 1:222170798-222170820 TCTGCACAGGATGGGTGGGGTGG - Intergenic
922333061 1:224594626-224594648 TTTGCACAGGAAAGGTCAGGCGG + Intronic
924816750 1:247448645-247448667 TCTGCACAGGAAGGCATCGTCGG - Exonic
1062932462 10:1362489-1362511 GCTGCGCAGGAAGGAACCGGAGG + Intronic
1063916485 10:10888058-10888080 TCTACACAGGCTGGGTGCGGTGG - Intergenic
1064128547 10:12686679-12686701 TTTGTACAGGAAGTGTCCGGAGG + Intronic
1065142515 10:22732694-22732716 TCTGAACAGGCCGGGTGCGGTGG - Intergenic
1067070466 10:43127161-43127183 CCTGCCCAGGAGGGGTCTGGGGG - Intronic
1068433620 10:56963388-56963410 TCTGCACAGGAAGGGCAGGGTGG - Intergenic
1069346425 10:67476199-67476221 TCTGCATAGGAAGGGTGGGTGGG - Intronic
1069346516 10:67476719-67476741 TATGCACAGGAAGTGTAGGGTGG - Intronic
1069346554 10:67476944-67476966 TCTGCACAGCAAGGCTGAGGCGG - Intronic
1069723887 10:70565539-70565561 TGGGCACAGGAAGGGTATGGGGG + Intronic
1071894585 10:90051630-90051652 TCTGCACAGGAGGGGTGAGCTGG + Intergenic
1072374819 10:94803822-94803844 TCTGTACAGGAAGGGGAGGGTGG + Intronic
1075407736 10:122205705-122205727 TCTGCAGAGGAAGGGGCGGATGG + Intronic
1075686432 10:124367992-124368014 TCTGCACAGGAAGGGGTGGAAGG + Intergenic
1076437861 10:130459102-130459124 GCTGGACAGGCAGGGTCAGGTGG + Intergenic
1076792064 10:132782175-132782197 GCTGCTCCGGAATGGTCCGGAGG - Exonic
1076878661 10:133229815-133229837 CCTGCACGCGAGGGGTCCGGAGG - Intergenic
1077425424 11:2473776-2473798 TCTGCACAGGTAGGGCCATGGGG + Intronic
1079256341 11:18834536-18834558 TCTGCACGGGAAGGGTTGGATGG + Intergenic
1081569357 11:44279872-44279894 TCAGCACAGGATAGGTCAGGTGG + Intronic
1081964478 11:47161295-47161317 TCTGCCAGGGAAGGGTCTGGGGG + Intronic
1083322706 11:61857198-61857220 TCTGCACAGCAAGGCTGCTGTGG - Intronic
1083931619 11:65849469-65849491 GATGCACAGGAAGGCTGCGGAGG - Exonic
1084408847 11:68994423-68994445 TCTTCCTAGGAAGGGTGCGGGGG + Intergenic
1084666590 11:70579638-70579660 CCTGCACAGGACAGGTCCCGGGG - Intronic
1085353573 11:75815862-75815884 TCCGCCCAGGAAGGGACCCGGGG + Intronic
1086042531 11:82495952-82495974 TCTGCACAGGAAGGATGGGATGG + Intergenic
1086494092 11:87384785-87384807 TCTGCCCAAGAAGGGTAGGGTGG - Intergenic
1086559852 11:88154928-88154950 TCTGCACAGGAGGGGTGGGATGG - Intronic
1087356229 11:97097928-97097950 TCTGCACAGGAAGGGTGGGGTGG - Intergenic
1088425449 11:109696779-109696801 TCTGCACAGGAAGGGGAGTGTGG - Intergenic
1089862726 11:121604380-121604402 TCTACACAGGAGGGGCCCTGGGG - Intronic
1090241417 11:125184656-125184678 TCAGCACAGGCAGGTTCCAGAGG - Intronic
1090407552 11:126486235-126486257 TCTGCACAGCAAGGGTGAGAGGG + Intronic
1090425364 11:126603551-126603573 TCTGCAGAGACAGGGTCAGGAGG - Intronic
1090854277 11:130598394-130598416 TCTGCACTGACAGGATCCGGAGG + Intergenic
1090930808 11:131296472-131296494 TCTGCACAGGCAGTGTCCTCAGG + Intergenic
1091647712 12:2286456-2286478 TCTGCACAGTAAGGACCCTGTGG + Intronic
1092183162 12:6460055-6460077 TCTCGACAGGCAGGGTGCGGTGG - Intronic
1092261944 12:6957632-6957654 TCTGGAAAGGGAGGGTCGGGTGG - Exonic
1095626273 12:44318584-44318606 TATGCACAGGAAAGGTGGGGTGG + Intronic
1095780028 12:46049081-46049103 TCTGCACAGGAGGGATGGGGTGG - Intergenic
1095780065 12:46049307-46049329 TCTGCACAGGAAGGGTAGGATGG - Intergenic
1095915639 12:47475226-47475248 TATGTACAGGAAGGGTAGGGTGG - Intergenic
1096189876 12:49609572-49609594 TCTACACAGGGAGGGTGGGGTGG - Intronic
1096717097 12:53498216-53498238 TCTGGACAGGAAGGCTCAGGGGG + Intronic
1097221642 12:57454740-57454762 CCAGCACAGGCAGGGTCAGGGGG + Intronic
1098371776 12:69767806-69767828 TCTGCACAGGAAGGTTGGGGTGG + Intronic
1098556660 12:71826014-71826036 TCTGGAGAGGAAGGCTCCTGTGG + Intergenic
1099743274 12:86669061-86669083 TCTGCACAGGAAAGGTGGTGTGG - Intronic
1100931918 12:99619302-99619324 TATGCACAGGAAGGGTAGGGTGG - Intronic
1101891732 12:108722445-108722467 CCTGCACAGGGAGGCTCCTGGGG + Intronic
1102115091 12:110396914-110396936 GCTGCACAGGCTGGGTGCGGTGG + Intronic
1104014595 12:124953538-124953560 TCTGCATGAGAAGGGTCTGGGGG + Intronic
1104637307 12:130446458-130446480 ACTGCGCAGGACGGGTCAGGAGG - Intronic
1107229193 13:38087181-38087203 TCTGCACAGGAAGACTGCAGTGG - Intergenic
1107297087 13:38921193-38921215 TCTGCAAAGGAAGGGTGGGATGG + Intergenic
1109192133 13:59338182-59338204 TCTGCAGAGGATGGATCCAGGGG - Intergenic
1109309155 13:60671995-60672017 TCTGCACAGGAATGATGGGGTGG + Intergenic
1109309215 13:60672334-60672356 TATGCACAGGAAGGGTTGGGTGG + Intergenic
1109646414 13:65264271-65264293 TCTGCACAGGAAGGGTGAGGTGG - Intergenic
1112078289 13:95936748-95936770 TCTGCACAGGCAGGGTGGCGTGG + Intronic
1112223289 13:97513365-97513387 TCTGCACAGGAAAGATGGGGTGG + Intergenic
1112223308 13:97513466-97513488 TCTGCACAGGAATGGTGGGGTGG + Intergenic
1113249128 13:108431699-108431721 TCAGCACAGGAAGGATAGGGAGG + Intergenic
1113619199 13:111701498-111701520 TCTGTGCTGGAAGGGTCCCGTGG - Intergenic
1113624728 13:111786759-111786781 TCTGTGCTGGAAGGGTCCCGTGG - Intergenic
1113920153 13:113903172-113903194 TCTGCACACTGCGGGTCCGGTGG + Intergenic
1114510946 14:23260259-23260281 GATGCAGAGGAAGGGTCCTGAGG - Intronic
1114613804 14:24057951-24057973 TCTCCACAGGAAGGGTCGAGAGG + Exonic
1114832720 14:26164329-26164351 TCTGCACAACAAGGGTTGGGTGG + Intergenic
1115291510 14:31777982-31778004 GCTGCACAGGAAGGTTTCTGAGG - Intronic
1115707603 14:36014634-36014656 TTTGAACTGGAATGGTCCGGCGG + Intergenic
1115963603 14:38863199-38863221 TCTGCACAGGAAGGGCAGGATGG + Intergenic
1116195772 14:41723243-41723265 TCTGCACAGAAAGGGTGGTGTGG + Intronic
1116295414 14:43100735-43100757 TCTGTGTAGGAAGGGGCCGGGGG - Intergenic
1116681322 14:47973658-47973680 TATGCACAGGAAGGGTGGAGTGG - Intergenic
1116781346 14:49240888-49240910 TCTGCAGAGGAAGGGTGGGGTGG + Intergenic
1117378736 14:55138943-55138965 TCTGGAAAGGAAGGATCCTGTGG - Intronic
1117824542 14:59687959-59687981 TCTTCACAGGAATGGTGGGGTGG - Intronic
1120279396 14:82420003-82420025 TCTGCATAGGAAGGGTAGGGTGG + Intergenic
1123039281 14:105483787-105483809 TCTGCAGAGGAAGGGGCTGTGGG + Intergenic
1123072591 14:105649009-105649031 CCTGCACAGGAAGGCTTCTGAGG + Intergenic
1124355998 15:28995163-28995185 TCTGCACAGGAAGGCTGAAGAGG - Intronic
1128146140 15:65333415-65333437 TCTGCAGAGGAAGGGGAGGGGGG + Exonic
1129315374 15:74739905-74739927 TCTTCACAGACAGGGTCTGGAGG + Intergenic
1130841250 15:87703302-87703324 CCTGAAGAGGAAGGGTCGGGGGG - Intergenic
1132593159 16:735253-735275 TCTGCACAGTCAGGGTCCGAGGG - Intronic
1135806627 16:25548545-25548567 CCTGCACAGGCTGGGTGCGGTGG + Intergenic
1140509173 16:75495062-75495084 TCTTCACTGGGAGGGTCCGCAGG + Intronic
1140521957 16:75589399-75589421 TCTCCACAGGAGAGGTACGGTGG - Intergenic
1140668399 16:77249469-77249491 TCAACACAGGAAGGGCGCGGTGG - Intronic
1141210318 16:81973589-81973611 TCTACACAGGAAGGGTGGGCTGG - Intergenic
1141508977 16:84500526-84500548 TCTGCACAGGAAGTCTCCACTGG + Intronic
1148864566 17:50621861-50621883 TCGGCCCAGGGAGGGTCCTGGGG + Intronic
1149020777 17:51962014-51962036 TCTGCACAGGAGGAGTTGGGTGG - Intronic
1149956440 17:61055955-61055977 TCTGCTCAGGATGGCTCTGGAGG + Intronic
1150891013 17:69149780-69149802 TCAGCACAGGAAGAATCAGGTGG + Intronic
1152279400 17:79376410-79376432 TCTGCAGAGAGAGGGTCCTGCGG - Intronic
1152678335 17:81653086-81653108 GCTGCACAGGAAGGGGAGGGCGG - Intronic
1152690800 17:81716871-81716893 TGTGCACAGGCAGGGTTCTGGGG + Intronic
1155676895 18:28440697-28440719 TCTGCACAGAAAGAGTCGGGTGG + Intergenic
1155676932 18:28440903-28440925 TCTGCACAGAAAGAGTGGGGTGG + Intergenic
1156084221 18:33379765-33379787 TCTGCACAAGAAAGGTAGGGTGG + Intronic
1157667694 18:49501530-49501552 TCAGCAAAGGGAGGGTCTGGAGG - Intergenic
1157940334 18:51921665-51921687 TATGCAGAGGAAGGGTGGGGTGG - Intergenic
1159320269 18:66838983-66839005 TCTGCACAGAAAGCGTGAGGTGG - Intergenic
1160875405 19:1294333-1294355 TCAGCCGAGGAAGGGACCGGCGG - Intronic
1162029295 19:7910431-7910453 GCTGCACAGGCAGGGACAGGAGG - Exonic
1165342099 19:35220081-35220103 TCTTTACAGGCAGGGTGCGGTGG - Intergenic
1165712905 19:38024807-38024829 ACAGCACAGGAAGGGACCTGAGG - Intronic
1166872481 19:45879252-45879274 CCTGCACAGAAAGGTTCCTGTGG + Intergenic
1167238932 19:48331722-48331744 TCTGCACAGGCCGGGTGCGGTGG + Intergenic
1167502083 19:49854185-49854207 TCTGGGAAGGAAGGGTCCTGAGG + Intronic
1168437670 19:56334294-56334316 TCTGCAAAGAAAGGGTGGGGTGG + Intronic
925375924 2:3385865-3385887 CCTGCACAGGAAGGACCCGAAGG + Intronic
925768439 2:7259671-7259693 TCTGCACAGGACAGGTGCAGTGG - Intergenic
926605579 2:14895449-14895471 TCTGCACAGGCAGGGCACTGTGG + Intergenic
928799312 2:35067767-35067789 TCTGCATAGGAAGGGTGGGGTGG - Intergenic
930166700 2:48210285-48210307 TCTTCACAGGCAGGGTGCGGTGG - Intergenic
930210842 2:48635252-48635274 TCTGCACAGGAAGGGTGGAGTGG + Intronic
931970566 2:67581581-67581603 TCTGCACAGGAGGGGTGTAGTGG - Intergenic
932097444 2:68864088-68864110 TCTGCACAGGAAGGGTCCGGTGG - Intergenic
935261915 2:101362960-101362982 TGAGCACAGTCAGGGTCCGGAGG - Intronic
936820191 2:116510795-116510817 TCTGAATAGGAAGGGTGAGGTGG + Intergenic
937725270 2:125156916-125156938 ACTGCACAGGCTGGGTGCGGTGG - Intergenic
937823214 2:126335075-126335097 TCTGCACAGGAAGGATAAGGTGG - Intergenic
939247549 2:139645238-139645260 TCTGCACAGGAAGGGTGGGGAGG + Intergenic
940081290 2:149804959-149804981 TCTGAACAGGAATGGTCTGTAGG - Intergenic
942232532 2:173873663-173873685 TGTGTTCAGGAAGGGTCAGGAGG - Intergenic
945335940 2:208592568-208592590 TATGCCCAGGAAGGGTACGGTGG - Intronic
947659299 2:231854912-231854934 TCTGCACAGAAAGGCTCGGCTGG + Intergenic
948200522 2:236127020-236127042 TCTGAACAGGAAAGGTGAGGGGG - Exonic
948580917 2:238986674-238986696 TCGGCTCAGGCAGGGTCTGGGGG + Intergenic
948598586 2:239095892-239095914 CCAGCCCAGGAAGGGGCCGGGGG - Intronic
948896736 2:240931151-240931173 CTTGCACAGGGAGGGCCCGGGGG + Intronic
1169515509 20:6312106-6312128 TCTTCACAGGAAGGGTGAGGTGG - Intergenic
1170070137 20:12357783-12357805 TCTTCACAAGAAGGGTGGGGTGG - Intergenic
1170116277 20:12863531-12863553 TCTGGAGAGGATGGGTGCGGGGG - Intergenic
1170905854 20:20514770-20514792 TCTGCACAAGAAAGGTGGGGTGG - Intronic
1173018655 20:39248850-39248872 GCTGGACAGGAAGTGTCCTGGGG + Intergenic
1173530919 20:43769101-43769123 TCCTCACAAGAAGGGTCTGGAGG - Intergenic
1176044765 20:63086817-63086839 ACTGCTCAGGGAGGGTCCCGGGG + Intergenic
1179175703 21:39006389-39006411 TCTGACCAGGAAGGGTTGGGTGG - Intergenic
1179943606 21:44655503-44655525 TCTGCAGAGGAGGTGTCCTGTGG - Intronic
1179947045 21:44685535-44685557 TCTGCAGAGGAGGTGTCCTGTGG + Intronic
1181033936 22:20161009-20161031 TCTGCTCAGCAAGGGGCCTGTGG - Intergenic
1181406776 22:22690530-22690552 TCAGCACAGAAAGGGCCCTGGGG - Intergenic
1181423106 22:22815454-22815476 TCAGGACAGGAAGGCTCCTGGGG - Intronic
1181441237 22:22936081-22936103 TCTGCCCAGGGAAGGTCCTGGGG - Intergenic
1181509420 22:23382394-23382416 TCTGCTCAGCAAGGGGCCTGTGG + Intergenic
1183267437 22:36837753-36837775 TCTGCAGAGTAAGGGCCCTGAGG - Intergenic
1183776260 22:39968149-39968171 GCTGCAGGGGAAGGGTCGGGGGG - Exonic
951193970 3:19803774-19803796 TATGCACAGGAAGGGTGGGATGG - Intergenic
951194006 3:19803999-19804021 TTTGCACAGGAAGGGTGGGGTGG - Intergenic
951236336 3:20240615-20240637 TCTGTACAGGGAGGGTTGGGTGG - Intergenic
951325396 3:21296854-21296876 TATGCACAGGAAGGGTGGGGTGG - Intergenic
951705655 3:25541821-25541843 TCTGTGGAGGAAGGGGCCGGAGG - Intronic
954064341 3:48093907-48093929 TCTACACAGGCAGGGCACGGTGG + Intergenic
954152598 3:48664960-48664982 TCTGCAAAGGAAGGGCAGGGAGG + Intergenic
954194081 3:48985873-48985895 TCTGCTTTGGAGGGGTCCGGAGG - Exonic
956292852 3:67679596-67679618 TGTGCACTGGAAGGGCCAGGTGG + Intergenic
958156433 3:89761543-89761565 TCTGCACAGGAAGGGTGAGGTGG + Intergenic
959948174 3:112149374-112149396 TCTGCACAGAAAGGATGGGGTGG + Intronic
961373234 3:126445390-126445412 TCTGCACAGGAAGGGTAAGCTGG + Intronic
961442192 3:126959743-126959765 TCCGCACAGTCAGGGTCCTGTGG - Intronic
961568920 3:127784577-127784599 TCTGCACAGGAAGAGCCCGTTGG + Intronic
962911588 3:139856026-139856048 TCTGCACAAGAAGAGTAGGGTGG + Intergenic
964652376 3:159026337-159026359 TCTGCACAGGAAAGGTAGGGAGG + Intronic
964652412 3:159026562-159026584 TATGCACAGGAAGGATAGGGTGG + Intronic
965940141 3:174169445-174169467 TGTGCACAGTAAGGGTGAGGTGG + Intronic
966459947 3:180165658-180165680 TCTGCACAGGAAGGGTGGGATGG + Intergenic
966460007 3:180165987-180166009 TATGCACAGGAAGGGTGGGGTGG + Intergenic
971066172 4:23035651-23035673 TATGCCCAGGAAGGGTGGGGTGG + Intergenic
974312759 4:60233902-60233924 TCTGCACAGGAAGGATGGGGTGG + Intergenic
974312779 4:60234015-60234037 TATGCACAGGAAGGGTGGGTTGG + Intergenic
974676043 4:65090490-65090512 TCTGCACAGGAATGGTGAGATGG + Intergenic
979139419 4:117153204-117153226 TCTGCACAGGAAAGCTGGGGTGG + Intergenic
979602027 4:122596314-122596336 CCTGTACAGGACGGGTGCGGTGG + Intergenic
979737450 4:124104829-124104851 TCTGCACAGGAAGGGTGTGGAGG + Intergenic
980023851 4:127740848-127740870 TCTGCACAGAAAGGGTAGGGTGG + Intronic
980032177 4:127844267-127844289 TCTGCACAGGAAGGGAAATGTGG - Intergenic
980381197 4:132019721-132019743 TCTGCACAGGAAGGAATTGGAGG + Intergenic
981198040 4:141943281-141943303 TCTGCACAAAAAGGGTACAGTGG - Intergenic
981679603 4:147381633-147381655 TCTGCACAGGATGGGTGGGGTGG - Intergenic
981987423 4:150874900-150874922 TCTGCAAAGGAAGAGTGGGGTGG - Intronic
985480367 5:106739-106761 GCTGCACAGGCAGGGACAGGAGG + Intergenic
985519971 5:369667-369689 TCTGCACAGGAAAGGTTTAGAGG - Intronic
985823849 5:2178721-2178743 GCTCCACAGGAAGGGGCCGTGGG + Intergenic
988406356 5:30827750-30827772 TCTACACAGGAAGGGTGGGCTGG + Intergenic
988646910 5:33105024-33105046 TCTGCACAGGAAGAGTAGGGTGG + Intergenic
988646949 5:33105249-33105271 TATGCACGGGAAGGGTGGGGTGG + Intergenic
993364581 5:87020101-87020123 TCTGCACAGGAAGGGAGGGGTGG + Intergenic
994161970 5:96566994-96567016 TCTGCACAAGAAGGGCCACGAGG + Intronic
994399673 5:99263805-99263827 TATGCACAAGAAGGGTGGGGTGG - Intergenic
994410592 5:99402995-99403017 TCTGCACAGGCAGCTTCCTGTGG - Intergenic
994483240 5:100362274-100362296 TCTGCACAGGCAGCTTCCTGTGG + Intergenic
995148248 5:108810866-108810888 TTTGCACAGAAAGGGTAGGGTGG + Intronic
998176650 5:139905444-139905466 TCTCCTCAGGAAGGGTCCGAAGG + Intronic
998703952 5:144737687-144737709 TCTGCACAGAAAGGATGGGGTGG + Intergenic
999197189 5:149790410-149790432 TCTGCACAGGGAGGGTGTGCAGG - Intronic
999240870 5:150126694-150126716 TCTGGACAGGATGTGTACGGAGG - Intronic
1000443829 5:161295923-161295945 TCTGCCAAGGAAGGGCCAGGTGG + Intronic
1001528504 5:172445944-172445966 TCTGCAGAGGCAGAGTCCGGAGG + Intronic
1002774689 6:318621-318643 TCTGGACAGGAAAGGCCCTGGGG - Intronic
1003982792 6:11405158-11405180 TCTGCTCAGGAAGGGGGCGAGGG - Intergenic
1004399896 6:15278669-15278691 TCAGCAGAGGAAGGGTCTGGGGG + Intronic
1008249821 6:49226326-49226348 TCTGCACAGGCAGGATGTGGTGG - Intergenic
1008496451 6:52138852-52138874 TTTGCACAGTAAGGGTCAAGCGG - Intergenic
1010543552 6:77122860-77122882 TCTGCACAGGAAGAGTGGGGTGG + Intergenic
1010543728 6:77124364-77124386 TCGGCACAAGAAGGGTGGGGTGG - Intergenic
1011954984 6:93015637-93015659 CCTGCTCAGGAAGGGTGGGGTGG - Intergenic
1011957210 6:93037749-93037771 TCTGCACAGGAAGGGTGGGGTGG + Intergenic
1012676091 6:102114988-102115010 TCTGCACAGGAAGGGCGAGGTGG + Intergenic
1015306577 6:131715583-131715605 CCTGCACAGGAAGGATGGGGTGG - Intronic
1016220846 6:141668456-141668478 TCTGCCCAGGAAGGGTGGGGAGG - Intergenic
1016220910 6:141668889-141668911 TCTGCACAGGAAAGGTGAGGTGG - Intergenic
1016814282 6:148289340-148289362 TTTCCACAGGAAGGGACCAGTGG - Intronic
1019277051 7:181372-181394 TGTGGACAGGAAGGGGCCGGCGG - Intergenic
1021189432 7:17602883-17602905 TCTACACAGGAAGGGTGGGGTGG - Intergenic
1021307026 7:19045239-19045261 TCTGCACAGGAAGGGTAGGGTGG - Intronic
1021351826 7:19602957-19602979 TATGCACAGGAAGAGTGGGGTGG + Intergenic
1023290109 7:38659834-38659856 GCTGCACGGGAAGGGTGGGGCGG - Intergenic
1023830043 7:44034017-44034039 TCTGGGCAGAAAGGGTCCCGTGG - Intergenic
1024405102 7:48969975-48969997 TCTGCACAGGAATGGTGAGGTGG - Intergenic
1024814365 7:53250679-53250701 TCTGCATAGGACGGGTGCGATGG - Intergenic
1028333238 7:89622480-89622502 TCTGCACAGGCAGGGTGAAGTGG - Intergenic
1029740357 7:102488304-102488326 TCTGGGCAGAAAGGGTCCCGTGG - Intronic
1029758353 7:102587476-102587498 TCTGGGCAGAAAGGGTCCCGTGG - Intronic
1029776291 7:102686555-102686577 TCTGGGCAGAAAGGGTCCCGTGG - Intergenic
1032669021 7:134066502-134066524 TCTGCACAGGAAAGGGACTGTGG + Intronic
1033730972 7:144178917-144178939 CCTGCACAGGAAGGATGGGGTGG + Intergenic
1034429297 7:151033229-151033251 CCTGGACAGGAAGGGGCCGGGGG - Intronic
1035283583 7:157792691-157792713 TCTGCCCAGGCTGGGGCCGGGGG + Intronic
1039474650 8:37833316-37833338 TCTGCACAGGCAGGAACAGGAGG - Intronic
1040662931 8:49596537-49596559 TGTGCACTGGAAGGGTGGGGTGG + Intergenic
1042109651 8:65367329-65367351 TCTGCACAGGAAGGGTGGGGTGG - Intergenic
1043655750 8:82663058-82663080 TATGCCCAGGAAGGGTACAGTGG + Intergenic
1043773608 8:84236419-84236441 TCCCCACAGGAAGGGTTCTGTGG + Intronic
1044015270 8:87043101-87043123 TCTGCAGAGGCAGGGGCCAGTGG + Intronic
1044308445 8:90665471-90665493 TCCGCACAGGAAGGGTGGAGTGG - Intronic
1044308554 8:90666097-90666119 TTTGCACAGGAAGGGTGGGGTGG + Intronic
1044955542 8:97476001-97476023 TCTGCACAGGAATGGTGGGGTGG - Intergenic
1046606310 8:116375342-116375364 TGTGCACAGGAAGGGTAGGGTGG + Intergenic
1047106242 8:121733694-121733716 CCAGCACAGAAAGGGTCCTGAGG - Intergenic
1047566193 8:126046784-126046806 TTTGCACAGGAAGGGTGGAGTGG + Intergenic
1047575405 8:126148924-126148946 TCTGCACAGGAAGGGTGGGATGG - Intergenic
1049853583 8:144847951-144847973 TCTGTACTGGAGGGGTCCAGTGG + Intronic
1050619039 9:7433638-7433660 TCTGCACAGGAAGGGTGTGGTGG + Intergenic
1050619059 9:7433751-7433773 TCTGCACAGGAAGGGTGGGGTGG + Intergenic
1050687686 9:8190420-8190442 TCTGCACAGAAAGGGTGGAGTGG - Intergenic
1053014074 9:34652021-34652043 ACGGGACAGGAAGTGTCCGGCGG + Exonic
1055401813 9:75932357-75932379 TCTGCAAAGGAAGGGTGGGAAGG - Exonic
1055673988 9:78636387-78636409 TCTGGACAGACAGGGTCCAGTGG - Intergenic
1055736539 9:79336651-79336673 TCTGCACAGGAAGGGCGAGGTGG + Intergenic
1055818169 9:80231809-80231831 TCTACACAGGAAGGGTGGGGTGG + Intergenic
1057222444 9:93264486-93264508 TCTGCACAGGCAGGGAGGGGTGG - Intronic
1059453467 9:114385469-114385491 TCTGCTGAGGAAGGGGCCGGGGG + Intronic
1060314829 9:122499623-122499645 TCTGCACAGGAAGAATAGGGTGG + Intergenic
1060970317 9:127734158-127734180 TCTGTGCAGGATGGGTCCTGAGG + Intronic
1061819986 9:133221949-133221971 TCTGCCCAGGCAGGTTCAGGGGG - Intergenic
1061843872 9:133376047-133376069 CCTCCACAGGAAGTGCCCGGCGG + Exonic
1062240663 9:135535996-135536018 TCTGCCCAGGCAGGTTCAGGGGG + Intergenic
1062497512 9:136838722-136838744 TCTGAGCAGGAAGGGGTCGGGGG - Intronic
1203779929 EBV:95722-95744 TCTGGACCAGAAGGCTCCGGCGG + Intergenic
1186285080 X:8034342-8034364 TCTTCACAGGAGGGGTCCATAGG - Intergenic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1187688388 X:21839566-21839588 TCCCCACTGGAAGAGTCCGGTGG + Intergenic
1189338514 X:40186456-40186478 ACTGCACAGGCTGGGTGCGGTGG - Intergenic
1193026566 X:76851592-76851614 TATGCTCAGGAAGGGTCTGGTGG + Intergenic
1193031811 X:76906966-76906988 TATGCACAGGAAGGGTGGGCTGG - Intergenic
1193031881 X:76907416-76907438 TCTTCACAGGAATGGTTGGGTGG - Intergenic
1194157155 X:90404977-90404999 TCTGAACAGGAAGGGTGAGGTGG - Intergenic
1197390798 X:125861368-125861390 TCTGCTCAGGAAGGTTAGGGGGG - Intergenic
1198975745 X:142333613-142333635 TCTGCACAGAAAAGGTGGGGTGG - Intergenic
1200503485 Y:3981959-3981981 TCTGAACAGGAAGGGTGAGGTGG - Intergenic
1201721374 Y:17101274-17101296 TCTGCACAGCAATGGTCCATGGG + Intergenic