ID: 932099501

View in Genome Browser
Species Human (GRCh38)
Location 2:68884942-68884964
Sequence CTTGTCTGCAGTAGAATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932099499_932099501 -1 Left 932099499 2:68884920-68884942 CCTTAAATATAAAATGACTTCTC No data
Right 932099501 2:68884942-68884964 CTTGTCTGCAGTAGAATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932099501 Original CRISPR CTTGTCTGCAGTAGAATTTT GGG Intergenic
No off target data available for this crispr