ID: 932099501 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:68884942-68884964 |
Sequence | CTTGTCTGCAGTAGAATTTT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
932099499_932099501 | -1 | Left | 932099499 | 2:68884920-68884942 | CCTTAAATATAAAATGACTTCTC | No data | ||
Right | 932099501 | 2:68884942-68884964 | CTTGTCTGCAGTAGAATTTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
932099501 | Original CRISPR | CTTGTCTGCAGTAGAATTTT GGG | Intergenic | ||
No off target data available for this crispr |