ID: 932099612

View in Genome Browser
Species Human (GRCh38)
Location 2:68885942-68885964
Sequence CATTCTGACGGGAGTGTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932099607_932099612 8 Left 932099607 2:68885911-68885933 CCAAAGACAGCCTGAATCACCGA No data
Right 932099612 2:68885942-68885964 CATTCTGACGGGAGTGTATTAGG No data
932099605_932099612 15 Left 932099605 2:68885904-68885926 CCTCTGCCCAAAGACAGCCTGAA No data
Right 932099612 2:68885942-68885964 CATTCTGACGGGAGTGTATTAGG No data
932099606_932099612 9 Left 932099606 2:68885910-68885932 CCCAAAGACAGCCTGAATCACCG No data
Right 932099612 2:68885942-68885964 CATTCTGACGGGAGTGTATTAGG No data
932099608_932099612 -2 Left 932099608 2:68885921-68885943 CCTGAATCACCGACACAATAGCA No data
Right 932099612 2:68885942-68885964 CATTCTGACGGGAGTGTATTAGG No data
932099604_932099612 27 Left 932099604 2:68885892-68885914 CCAGGCAGATTGCCTCTGCCCAA No data
Right 932099612 2:68885942-68885964 CATTCTGACGGGAGTGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932099612 Original CRISPR CATTCTGACGGGAGTGTATT AGG Intergenic
No off target data available for this crispr