ID: 932101765

View in Genome Browser
Species Human (GRCh38)
Location 2:68907915-68907937
Sequence CACAGCTACTTTCTTAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932101765_932101774 17 Left 932101765 2:68907915-68907937 CCTACATTAAGAAAGTAGCTGTG No data
Right 932101774 2:68907955-68907977 AATTCCAGCTCCTGAAGGTGGGG No data
932101765_932101777 25 Left 932101765 2:68907915-68907937 CCTACATTAAGAAAGTAGCTGTG No data
Right 932101777 2:68907963-68907985 CTCCTGAAGGTGGGGCTGGCAGG No data
932101765_932101780 27 Left 932101765 2:68907915-68907937 CCTACATTAAGAAAGTAGCTGTG No data
Right 932101780 2:68907965-68907987 CCTGAAGGTGGGGCTGGCAGGGG No data
932101765_932101776 21 Left 932101765 2:68907915-68907937 CCTACATTAAGAAAGTAGCTGTG No data
Right 932101776 2:68907959-68907981 CCAGCTCCTGAAGGTGGGGCTGG No data
932101765_932101772 15 Left 932101765 2:68907915-68907937 CCTACATTAAGAAAGTAGCTGTG No data
Right 932101772 2:68907953-68907975 CCAATTCCAGCTCCTGAAGGTGG No data
932101765_932101769 12 Left 932101765 2:68907915-68907937 CCTACATTAAGAAAGTAGCTGTG No data
Right 932101769 2:68907950-68907972 ATCCCAATTCCAGCTCCTGAAGG No data
932101765_932101778 26 Left 932101765 2:68907915-68907937 CCTACATTAAGAAAGTAGCTGTG No data
Right 932101778 2:68907964-68907986 TCCTGAAGGTGGGGCTGGCAGGG No data
932101765_932101773 16 Left 932101765 2:68907915-68907937 CCTACATTAAGAAAGTAGCTGTG No data
Right 932101773 2:68907954-68907976 CAATTCCAGCTCCTGAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932101765 Original CRISPR CACAGCTACTTTCTTAATGT AGG (reversed) Intergenic
No off target data available for this crispr