ID: 932103318

View in Genome Browser
Species Human (GRCh38)
Location 2:68920781-68920803
Sequence GTAGTTCAGCCTGTCTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932103317_932103318 6 Left 932103317 2:68920752-68920774 CCAGATTGCTTTTCAATCAGTCT No data
Right 932103318 2:68920781-68920803 GTAGTTCAGCCTGTCTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932103318 Original CRISPR GTAGTTCAGCCTGTCTCTTT TGG Intergenic
No off target data available for this crispr