ID: 932103617

View in Genome Browser
Species Human (GRCh38)
Location 2:68923544-68923566
Sequence GAGTGGGGCCAGATGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932103617_932103633 28 Left 932103617 2:68923544-68923566 CCGTCTTCCATCTGGCCCCACTC No data
Right 932103633 2:68923595-68923617 CCACTCCGGACACTTCAGGATGG No data
932103617_932103634 29 Left 932103617 2:68923544-68923566 CCGTCTTCCATCTGGCCCCACTC No data
Right 932103634 2:68923596-68923618 CACTCCGGACACTTCAGGATGGG No data
932103617_932103627 14 Left 932103617 2:68923544-68923566 CCGTCTTCCATCTGGCCCCACTC No data
Right 932103627 2:68923581-68923603 GACATTCCCTCCAGCCACTCCGG No data
932103617_932103631 24 Left 932103617 2:68923544-68923566 CCGTCTTCCATCTGGCCCCACTC No data
Right 932103631 2:68923591-68923613 CCAGCCACTCCGGACACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932103617 Original CRISPR GAGTGGGGCCAGATGGAAGA CGG (reversed) Intergenic
No off target data available for this crispr