ID: 932103874

View in Genome Browser
Species Human (GRCh38)
Location 2:68925585-68925607
Sequence CTCCACTTACTCATGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932103867_932103874 -10 Left 932103867 2:68925572-68925594 CCCCATGCACTGCCTCCACTTAC No data
Right 932103874 2:68925585-68925607 CTCCACTTACTCATGGGCCAGGG No data
932103865_932103874 28 Left 932103865 2:68925534-68925556 CCTGTTTGGGTTCGGAGCTATTC No data
Right 932103874 2:68925585-68925607 CTCCACTTACTCATGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932103874 Original CRISPR CTCCACTTACTCATGGGCCA GGG Intergenic
No off target data available for this crispr