ID: 932104002

View in Genome Browser
Species Human (GRCh38)
Location 2:68926495-68926517
Sequence CTGAGGGGCTGGGGTTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932103994_932104002 -1 Left 932103994 2:68926473-68926495 CCAGCAGGAAAACAGGGAGAACC No data
Right 932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932104002 Original CRISPR CTGAGGGGCTGGGGTTCAGA AGG Intergenic
No off target data available for this crispr