ID: 932104136

View in Genome Browser
Species Human (GRCh38)
Location 2:68927459-68927481
Sequence TTGCAAATGAATAAGGACCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932104130_932104136 11 Left 932104130 2:68927425-68927447 CCCTTTAGTGGTAACTCCCAGGC No data
Right 932104136 2:68927459-68927481 TTGCAAATGAATAAGGACCACGG No data
932104132_932104136 -5 Left 932104132 2:68927441-68927463 CCCAGGCATTTCTCTCCATTGCA No data
Right 932104136 2:68927459-68927481 TTGCAAATGAATAAGGACCACGG No data
932104133_932104136 -6 Left 932104133 2:68927442-68927464 CCAGGCATTTCTCTCCATTGCAA No data
Right 932104136 2:68927459-68927481 TTGCAAATGAATAAGGACCACGG No data
932104126_932104136 30 Left 932104126 2:68927406-68927428 CCTTTGGAACTGGCCTAAGCCCT No data
Right 932104136 2:68927459-68927481 TTGCAAATGAATAAGGACCACGG No data
932104128_932104136 17 Left 932104128 2:68927419-68927441 CCTAAGCCCTTTAGTGGTAACTC No data
Right 932104136 2:68927459-68927481 TTGCAAATGAATAAGGACCACGG No data
932104131_932104136 10 Left 932104131 2:68927426-68927448 CCTTTAGTGGTAACTCCCAGGCA No data
Right 932104136 2:68927459-68927481 TTGCAAATGAATAAGGACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932104136 Original CRISPR TTGCAAATGAATAAGGACCA CGG Intergenic
No off target data available for this crispr