ID: 932105318

View in Genome Browser
Species Human (GRCh38)
Location 2:68936495-68936517
Sequence TCCAGGGCTTTGAGGGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932105318_932105324 3 Left 932105318 2:68936495-68936517 CCTGTAACCCTCAAAGCCCTGGA No data
Right 932105324 2:68936521-68936543 GGTACCATAATAAAACCAAAAGG No data
932105318_932105326 11 Left 932105318 2:68936495-68936517 CCTGTAACCCTCAAAGCCCTGGA No data
Right 932105326 2:68936529-68936551 AATAAAACCAAAAGGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932105318 Original CRISPR TCCAGGGCTTTGAGGGTTAC AGG (reversed) Intergenic
No off target data available for this crispr