ID: 932105324

View in Genome Browser
Species Human (GRCh38)
Location 2:68936521-68936543
Sequence GGTACCATAATAAAACCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932105321_932105324 -5 Left 932105321 2:68936503-68936525 CCTCAAAGCCCTGGAATTGGTAC No data
Right 932105324 2:68936521-68936543 GGTACCATAATAAAACCAAAAGG No data
932105316_932105324 4 Left 932105316 2:68936494-68936516 CCCTGTAACCCTCAAAGCCCTGG No data
Right 932105324 2:68936521-68936543 GGTACCATAATAAAACCAAAAGG No data
932105310_932105324 27 Left 932105310 2:68936471-68936493 CCCACCCCACTGAAAGCCTGGTT No data
Right 932105324 2:68936521-68936543 GGTACCATAATAAAACCAAAAGG No data
932105314_932105324 21 Left 932105314 2:68936477-68936499 CCACTGAAAGCCTGGTTCCCTGT No data
Right 932105324 2:68936521-68936543 GGTACCATAATAAAACCAAAAGG No data
932105313_932105324 22 Left 932105313 2:68936476-68936498 CCCACTGAAAGCCTGGTTCCCTG No data
Right 932105324 2:68936521-68936543 GGTACCATAATAAAACCAAAAGG No data
932105312_932105324 23 Left 932105312 2:68936475-68936497 CCCCACTGAAAGCCTGGTTCCCT No data
Right 932105324 2:68936521-68936543 GGTACCATAATAAAACCAAAAGG No data
932105320_932105324 -4 Left 932105320 2:68936502-68936524 CCCTCAAAGCCCTGGAATTGGTA No data
Right 932105324 2:68936521-68936543 GGTACCATAATAAAACCAAAAGG No data
932105311_932105324 26 Left 932105311 2:68936472-68936494 CCACCCCACTGAAAGCCTGGTTC No data
Right 932105324 2:68936521-68936543 GGTACCATAATAAAACCAAAAGG No data
932105318_932105324 3 Left 932105318 2:68936495-68936517 CCTGTAACCCTCAAAGCCCTGGA No data
Right 932105324 2:68936521-68936543 GGTACCATAATAAAACCAAAAGG No data
932105315_932105324 11 Left 932105315 2:68936487-68936509 CCTGGTTCCCTGTAACCCTCAAA No data
Right 932105324 2:68936521-68936543 GGTACCATAATAAAACCAAAAGG No data
932105309_932105324 28 Left 932105309 2:68936470-68936492 CCCCACCCCACTGAAAGCCTGGT No data
Right 932105324 2:68936521-68936543 GGTACCATAATAAAACCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932105324 Original CRISPR GGTACCATAATAAAACCAAA AGG Intergenic
No off target data available for this crispr