ID: 932106692

View in Genome Browser
Species Human (GRCh38)
Location 2:68949713-68949735
Sequence CAGAAAAAGAACAATTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 762
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 704}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932106692 Original CRISPR CAGAAAAAGAACAATTGGTC AGG (reversed) Intronic
902121579 1:14170376-14170398 AAGAAAAAAAAAAATAGGTCTGG + Intergenic
902711043 1:18239972-18239994 CAGAATAAGAACAATGGGCTGGG + Intronic
904547989 1:31291682-31291704 TAAAAAAAGAAAAATTTGTCTGG + Intronic
904752885 1:32752007-32752029 CATAAAAAGAACAGTTAGTATGG - Intronic
904947584 1:34210813-34210835 CAAAAATACAACAATTAGTCAGG - Intronic
905646834 1:39630775-39630797 AAGAGGAAGAACAAGTGGTCTGG - Intronic
905726038 1:40252828-40252850 CAGAAAAAAAACATTTCATCTGG + Intergenic
905761638 1:40563285-40563307 CAGAAAAAGATAAAATGCTCTGG - Intergenic
905959067 1:42028126-42028148 AAGAAAAATAAAACTTGGTCAGG - Intronic
906193089 1:43911302-43911324 AAGAAAAAGAAATATTAGTCAGG - Intronic
906230284 1:44156798-44156820 CAAAAAAACAAAAATTAGTCGGG - Intergenic
906235818 1:44208591-44208613 TAGAAAAAGAAAAATTAGCCAGG - Intergenic
906342555 1:44993475-44993497 AAGAAAAAAAAAAATTGGCCAGG - Intergenic
906379486 1:45323360-45323382 CAGAAAAAGAAAAATTAGCCAGG - Intergenic
906485807 1:46233916-46233938 AAGAAAAAAAACAATAGGCCAGG - Intergenic
906491192 1:46270072-46270094 CAAAAAAAAAAAAATTGGCCGGG + Intronic
906652470 1:47522461-47522483 GAGAACAAGAAACATTGGTCTGG + Intergenic
907074836 1:51568725-51568747 GAGAAAAAGAAAAATTAGCCAGG - Intergenic
907247245 1:53116032-53116054 CAGATAAAGAAGTATTTGTCTGG + Intronic
907493843 1:54828490-54828512 CCAAAAAAGAAAAATTGGCCAGG - Intronic
907544976 1:55252071-55252093 CAAAAAAAAAAAAATTGGCCAGG - Intergenic
908230753 1:62102698-62102720 CCGAAAAAGCACAATTAGCCAGG + Intronic
908744630 1:67363509-67363531 AAGAATAAGAATAATTGGCCGGG - Intronic
908921188 1:69194727-69194749 GGGAAGAAGAACATTTGGTCAGG - Intergenic
910763266 1:90756107-90756129 CAAAAATACAAAAATTGGTCGGG + Intergenic
910800964 1:91145625-91145647 CATATAAAGAAAAATTGGCCGGG - Intergenic
911136767 1:94449018-94449040 CAGAAGCAGAACAACTGGTTTGG + Intronic
911352458 1:96771039-96771061 AAGAAAAAGAACATTTGACCAGG - Intronic
911488351 1:98530396-98530418 AAAAAAAAGAAAAATTAGTCGGG - Intergenic
911491163 1:98567951-98567973 AAAAAAAAAAAAAATTGGTCTGG + Intergenic
912140545 1:106720437-106720459 CAGAAATACAACAATTGGCTGGG - Intergenic
912519733 1:110237154-110237176 AAGAAAAAGAAAAATTAGCCAGG + Intronic
912616478 1:111105312-111105334 CTTAAAAAGAAAAATTGTTCTGG - Intergenic
912920590 1:113862809-113862831 CAGAAGAAGTACAAGTGGTAAGG + Intronic
913332497 1:117678948-117678970 CAGAAAAAGCACAGGTGCTCTGG - Intergenic
914084518 1:144440811-144440833 AAGAAAAAGAAAAATTAGCCGGG - Intronic
914813240 1:151044967-151044989 CAGAAAAAGACCAGGTGGTCGGG + Intronic
915125032 1:153657972-153657994 CAGAAAATGAAAAATTAGTCAGG + Intergenic
915180191 1:154052150-154052172 CAGAAGCAGAACAATTGGTTTGG + Intronic
915324108 1:155071704-155071726 CAGAAAAAGAACAAAACTTCAGG - Intergenic
916060566 1:161095816-161095838 CAGAAAACCAACAATTGGGCTGG - Intergenic
916548792 1:165830164-165830186 CAAAAAAAAAAAAATTAGTCGGG - Intronic
916853589 1:168727697-168727719 CAGAAAAAAAAAAATTAGCCCGG - Intronic
916891907 1:169120291-169120313 CAGTAAAAAAACAGATGGTCTGG - Intronic
917106655 1:171498966-171498988 AACAAAATGAACAATTGGCCAGG - Intronic
917615491 1:176739651-176739673 CAAAAAAATAAAAATTGCTCTGG - Exonic
917799311 1:178555763-178555785 CAGAAACAGAACAACTGATTTGG - Intergenic
917816319 1:178713373-178713395 CAAAAAAAGGCCAATGGGTCTGG + Intergenic
918538886 1:185605705-185605727 CATAAAAAGAAGCATTGCTCAGG - Intergenic
919012809 1:191987162-191987184 TAAAAATATAACAATTGGTCGGG + Intergenic
919016035 1:192038061-192038083 CAGAAAAAGAACACTGAGGCCGG + Intergenic
919273524 1:195382796-195382818 CAAAAAAAGAAAAATTAGCCAGG + Intergenic
919590631 1:199497779-199497801 CAGAAAAAGAAGAACTAGGCCGG + Intergenic
919905642 1:202076553-202076575 GAGAAAAAGAACCAATGGGCAGG - Intergenic
920368668 1:205463153-205463175 GAGAGAGAGATCAATTGGTCGGG - Intergenic
920428029 1:205894365-205894387 CAGAAGCAGAACAACTGGTTTGG + Intergenic
921006199 1:211095758-211095780 AGGAAACAGAACAATTGGTCTGG + Intronic
921026524 1:211288047-211288069 CAAAAAAAGAAAAATTAGCCAGG + Intronic
921472201 1:215562831-215562853 GAGAAAAAGCATAATTGGTGGGG - Intergenic
921603296 1:217130391-217130413 AAGAAAAAGAAAAATTAGCCAGG - Intronic
921637352 1:217512159-217512181 CAAAAAAAGAAAAATTAGCCAGG + Intronic
921685825 1:218088132-218088154 CACAAAAAAAACAATTAGCCTGG + Intergenic
922047797 1:221963621-221963643 AAGAAAAAGAAAAGTTGGCCAGG + Intergenic
923017187 1:230135986-230136008 CAGAAAGAGAGCACTTGGCCAGG - Intronic
923392085 1:233522075-233522097 CATAAAAATAACAACTGGCCAGG - Intergenic
923634786 1:235684777-235684799 CAAAAATAAAAAAATTGGTCAGG - Intronic
924022174 1:239795866-239795888 CAGACTAAGATGAATTGGTCAGG - Intronic
924379236 1:243446554-243446576 CACAAAGAAAAAAATTGGTCAGG - Intronic
924765488 1:247028381-247028403 CAGAAACAGAACAACTGATTTGG + Intergenic
1063325745 10:5099994-5100016 CAGAAAGAGAAAAATTAGGCCGG + Intronic
1064058623 10:12118718-12118740 CAGAAAAGGAACAATAGGGTGGG - Intronic
1064666572 10:17658514-17658536 CAAAAAAAGAAGAAATGGACAGG - Intronic
1064716812 10:18184998-18185020 CAAAAAATGAAAAATTGGCCAGG - Intronic
1064893190 10:20203463-20203485 AAGAAAAAGAAAAATTAGCCAGG - Intronic
1065150551 10:22818129-22818151 AAAAAAAAAAAAAATTGGTCGGG - Intergenic
1065343872 10:24729889-24729911 CACAAAGAGAACACTTGGTATGG + Intergenic
1065450732 10:25853882-25853904 AAGAAAAATAACAACTGGCCAGG + Intergenic
1066586026 10:36936476-36936498 AAGAAAAAGAAAAATTAGTATGG + Intergenic
1066989612 10:42500442-42500464 CAGAAACAGAACAACTGATTTGG + Intergenic
1067005362 10:42655630-42655652 CAAAAAAATAAAAATTAGTCTGG + Intergenic
1067803333 10:49375701-49375723 CAGAAAAAGAACATGTGCACTGG - Intronic
1068161414 10:53270093-53270115 CAGAAACAGCATAATTGGACGGG + Intergenic
1068589072 10:58834924-58834946 AAGAAAAAGAAAAATTAGGCAGG + Intergenic
1068708248 10:60101646-60101668 CACAGAAAGGACAGTTGGTCTGG - Intronic
1069258521 10:66364145-66364167 TATAACAAGAACAATTTGTCAGG - Intronic
1069464553 10:68626975-68626997 TAGAAAAAGAACACTTGGATGGG + Intronic
1070034202 10:72705818-72705840 CAAAAAAAAAAAAATTAGTCGGG + Intronic
1070042601 10:72796276-72796298 CAAAAAAAGGAAAATTGGCCAGG + Intronic
1070623583 10:78032808-78032830 CAAAAAAAAAAAAATTGGCCGGG - Intergenic
1072257626 10:93635441-93635463 CAGTGAAAGAAAAATTGGTTTGG - Intronic
1072429870 10:95361356-95361378 CAGAAAAAAAACAATTGGCTTGG - Intronic
1073119654 10:101113766-101113788 CAGAAATAAAAGAATTGGCCAGG + Intronic
1073308747 10:102524299-102524321 AAGAAAAAGAAAAATTAGGCTGG - Intronic
1073959506 10:108910622-108910644 GAGACAAAGAACAAATGGTAGGG - Intergenic
1074646502 10:115459255-115459277 CAGAATAACAGCAATTGTTCAGG + Intronic
1075388279 10:122073514-122073536 CATTAAAAGAAGAATTGGTAAGG - Intronic
1076094314 10:127718672-127718694 AAGAAAAAGAAAAATGGGCCGGG + Intergenic
1076416700 10:130296017-130296039 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1077626314 11:3774921-3774943 CAGAAAATGAAGAATTTGTCAGG - Intronic
1078765314 11:14290961-14290983 CTGAAATAGAACAATTGCTGGGG + Intronic
1078974729 11:16460353-16460375 TAGAAAAGGAAGAATTAGTCTGG - Intronic
1079844282 11:25445211-25445233 CAGAAAAAGAAAAATAAATCTGG - Intergenic
1080893856 11:36432713-36432735 CAGAAAAAAAAGAAAGGGTCCGG - Intronic
1081443855 11:43110390-43110412 AAGAAAAAGAAAAAGTGGGCAGG + Intergenic
1081868708 11:46373445-46373467 CAGAAAAACAAAAATTAGCCAGG - Intronic
1082556880 11:54573823-54573845 AAGAAAAAGCACAAGGGGTCAGG + Intergenic
1083441632 11:62680318-62680340 AAGAAAAAGAAAAATTAGCCGGG - Intergenic
1083472648 11:62894459-62894481 CAAAAAAAGAACAAGAGGCCGGG + Intergenic
1084052795 11:66611749-66611771 AAGAAAAAGAGCAATTAGCCAGG - Intergenic
1084326798 11:68404996-68405018 CAAAAAAAAAAAAATTAGTCTGG + Intronic
1084326838 11:68405308-68405330 CAGAAAAAAAAAAATTAGCCCGG + Intronic
1085075852 11:73591205-73591227 AACAAAAAGAACAATGGCTCTGG + Intronic
1085571723 11:77564802-77564824 AAGAAAAAGAAAAATTAGCCAGG + Intronic
1085762278 11:79252393-79252415 CAAAAAAAGAAAAATTAGCCGGG - Intronic
1087349707 11:97016127-97016149 AATAAAAAGAACAACTAGTCTGG + Intergenic
1087765978 11:102154229-102154251 CAGAATCAGAACATTTGTTCAGG - Intronic
1088367918 11:109058394-109058416 CAGAATAAGAGCATTTGGACAGG - Intergenic
1088456608 11:110039295-110039317 CAGATGAAGAACATTTGCTCTGG - Intergenic
1089073114 11:115716504-115716526 TTAAAAAAGAACAATTGGTCTGG - Intergenic
1090070325 11:123538778-123538800 AATAAAAAAAACAATTAGTCAGG - Intronic
1090294712 11:125577250-125577272 TAAAAATACAACAATTGGTCGGG - Intronic
1090711883 11:129393963-129393985 AAGAAAAAGAACATTTCTTCTGG + Intronic
1090764837 11:129867475-129867497 CAGAAATAGAAAAATTAGCCGGG - Intronic
1091622610 12:2100755-2100777 CAAAAAAAGAAAAAAAGGTCGGG + Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092488105 12:8920404-8920426 TAGAAAAAGATCTTTTGGTCAGG - Intronic
1092969585 12:13679448-13679470 CAGAAAGAGAACAATTTCTAAGG - Intronic
1093193135 12:16098121-16098143 CCTAAAAAGACAAATTGGTCAGG + Intergenic
1093462675 12:19420619-19420641 CATAAAAAGAGCTATTGGCCGGG - Intronic
1093559572 12:20522063-20522085 CAGACAAAGAACAAATCTTCGGG + Intronic
1095184962 12:39190658-39190680 CAGAAGCAGAACAATTGGTTTGG - Intergenic
1095239489 12:39839893-39839915 CACAAAAGGAACAATAGGTTTGG - Intronic
1095323961 12:40864314-40864336 AAGAAAAAGAAAAATAGGTCTGG - Intronic
1095912710 12:47445100-47445122 CAGAAGCAGAACAATTGATTTGG - Intergenic
1096296225 12:50386569-50386591 CAGAAAAAGAACATTTTGGCCGG + Intronic
1096302771 12:50446299-50446321 CAAGAAAACAGCAATTGGTCAGG - Intronic
1096304782 12:50464686-50464708 CAAAAAAAGAATTGTTGGTCAGG - Intronic
1096450421 12:51735923-51735945 CAGAAACAGAACAACTGATTTGG - Intronic
1097026215 12:56057605-56057627 AAAAAAAAAAAAAATTGGTCTGG + Intergenic
1097369961 12:58766321-58766343 TAGAAAAAGAACAATATGTAAGG + Intronic
1097997439 12:65904471-65904493 CAGTTAAAGAACAATTGCTAAGG - Intronic
1098487331 12:71036572-71036594 CAGAGAAGGAACAATAGGCCTGG - Intergenic
1098724132 12:73940768-73940790 CAAAAAAAGAAAAATTAGCCAGG - Intergenic
1098861628 12:75717353-75717375 CAGAAGAATAACAATTTCTCTGG + Intergenic
1099419073 12:82430398-82430420 CAGAAAAAGAACAGCTGTACAGG - Intronic
1100949876 12:99835268-99835290 CACAAAAAGAAAAATTAGCCAGG + Intronic
1101099379 12:101376941-101376963 CAGAAATACAAAAATTGGCCGGG - Intronic
1101141393 12:101799653-101799675 CAGTAAAAGAACTCTTGTTCAGG - Intronic
1101357436 12:103993518-103993540 TAGAAAAACAACATTTGGCCTGG + Intronic
1102123443 12:110461437-110461459 CAAAAATAGAAAAATTAGTCAGG + Intronic
1102860525 12:116332316-116332338 AAGAAAAAGAACAACTGCCCAGG + Intergenic
1103529643 12:121591950-121591972 AAGAAAAAGAAAAATAGGCCGGG + Intergenic
1103773719 12:123349619-123349641 CATAAAAATAACATTTGGCCGGG + Intronic
1103855280 12:123964164-123964186 CAAAATAAAAACAATTGCTCAGG + Intronic
1104223487 12:126809115-126809137 CAAAAAAAAAAAAATTAGTCGGG - Intergenic
1104325531 12:127792768-127792790 AAGAAAAAGAAAAATTAGCCTGG + Intergenic
1105352594 13:19629456-19629478 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1105711022 13:23009240-23009262 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1106492495 13:30239540-30239562 CAGAAAAAAATTATTTGGTCAGG + Intronic
1106632452 13:31490192-31490214 AAGAAAAAGAAAAATCTGTCAGG - Intergenic
1106757943 13:32840909-32840931 AAGAAGGAGTACAATTGGTCGGG - Intergenic
1106833216 13:33607589-33607611 CAGAAAAGAAACAATGGGCCAGG - Intergenic
1107101277 13:36595967-36595989 AGAAAAAAGAACAATTGATCAGG - Intergenic
1107849568 13:44557165-44557187 CAAAAAAAGAAAAAGTGGCCGGG + Intronic
1108276090 13:48811175-48811197 AAGAAAAAGAACAATTGGCTAGG + Intergenic
1108276296 13:48813407-48813429 AAGAAAAAGAACAATTGACCAGG - Intergenic
1108362373 13:49678848-49678870 CAAAAAAATAAAAATTAGTCAGG + Intronic
1108725915 13:53181236-53181258 CAGAAAAAGAAAACTTGCTCTGG - Intergenic
1109654542 13:65372462-65372484 CAAAAATAGAAAAATTGGCCGGG + Intergenic
1109927982 13:69171826-69171848 TAGAAAAATTACAATTGGGCCGG + Intergenic
1110026830 13:70551160-70551182 CAAAAAAAAAAAAATTAGTCAGG + Intergenic
1110362934 13:74648238-74648260 AAGAAAAAGATAAATTAGTCTGG - Intergenic
1110469008 13:75837022-75837044 CAGAAAAATAAGAATAGATCCGG + Intronic
1111077498 13:83257067-83257089 CATAAAAAGAATAATTGAACAGG + Intergenic
1112453707 13:99538027-99538049 CAGGAAAATAACTATTGGTATGG - Intronic
1112763838 13:102719715-102719737 CAGAAAATAAAAAATTGGCCAGG + Intergenic
1113017025 13:105838922-105838944 CAGAAAAAGAGAATTGGGTCTGG - Intergenic
1114723065 14:24903946-24903968 AAGAAAATGAAGATTTGGTCAGG - Intronic
1114923895 14:27368328-27368350 CAGAGAAATAACAGTTGGCCAGG - Intergenic
1115074426 14:29369620-29369642 CTGAAAAACAAAAATTAGTCGGG - Intergenic
1115355963 14:32448007-32448029 CTGAAAAAGGACCTTTGGTCCGG - Intronic
1116034032 14:39606653-39606675 CAGAACAAAAACAATTTTTCTGG - Intergenic
1116238239 14:42308825-42308847 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1117083011 14:52170849-52170871 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1118236098 14:64006665-64006687 CAAAAAAAGAAAAATTAGCCAGG + Intronic
1118541041 14:66825894-66825916 CTGAAAAAGTACAATTGGGAAGG + Intronic
1118980842 14:70715542-70715564 AAGAAAAAGAAAAATTAGTCGGG + Intergenic
1119262619 14:73246389-73246411 AAAAAAAAAAAAAATTGGTCGGG - Intronic
1119579701 14:75766722-75766744 CAGAAAAAGAGTGATTGGTCTGG + Intronic
1120383192 14:83808903-83808925 AAGAAAAAGAAAATTTAGTCTGG + Intergenic
1120724845 14:87927126-87927148 AAGAAATAGAAAAATTGGCCAGG + Intronic
1120764413 14:88315724-88315746 TAGAAAATGAAAATTTGGTCGGG - Intronic
1120992131 14:90386473-90386495 CAGAAAAGCAACAATAGATCAGG - Intergenic
1121568523 14:94929106-94929128 CAAAAAAAAAAAAATTAGTCAGG + Intergenic
1121843413 14:97153155-97153177 CAGTAAAAGAAAAATAGGCCTGG - Intergenic
1121982834 14:98469501-98469523 CAGAAAAAGCTGAGTTGGTCAGG + Intergenic
1122653123 14:103237684-103237706 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1202843499 14_GL000009v2_random:145719-145741 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1202845446 14_GL000009v2_random:168802-168824 CAAAAGAAGAAATATTGGTCTGG - Intergenic
1202914845 14_GL000194v1_random:159068-159090 CAAAAGAAGAAATATTGGTCAGG - Intergenic
1202875346 14_GL000225v1_random:202417-202439 CAAAAGAAGAAATATTGGTCTGG + Intergenic
1202877824 14_KI270722v1_random:23641-23663 CAAAAGAAGAAATATTGGTCTGG + Intergenic
1123900712 15:24873740-24873762 CATAAAAAGAAGAGTTGGCCAGG - Intronic
1124828276 15:33121825-33121847 CAGAAAAACAAAAATTTGGCCGG - Intronic
1124930335 15:34113504-34113526 CAGAAAATAAACAATTAGCCAGG - Intergenic
1125400784 15:39300468-39300490 GAGAAAAAGCAGATTTGGTCTGG + Intergenic
1125868814 15:43078670-43078692 CAGAAATAGAAAAACTGGCCAGG + Intronic
1126155242 15:45559755-45559777 CAAAAAAAAAACAATTAGCCGGG - Intergenic
1126448267 15:48775516-48775538 AAATAGAAGAACAATTGGTCAGG + Intronic
1127072017 15:55296519-55296541 AAGAAAAACAAAACTTGGTCTGG + Intronic
1127120156 15:55764964-55764986 AAGAAAAAGAAAAATTAGCCAGG + Intergenic
1127430706 15:58904689-58904711 CAGACAAAAAAAAATTGGCCGGG - Intronic
1127729446 15:61785230-61785252 CAAAAAAATCACAATTGGGCTGG - Intergenic
1128667649 15:69550236-69550258 CAGAAAAAAAATAATGGGTTTGG + Intergenic
1129347816 15:74935332-74935354 AAGAAAAAGAAAAATTTGGCTGG + Intronic
1130623332 15:85487025-85487047 CAAAAACTGAACAATTGGCCAGG - Intronic
1131037778 15:89235475-89235497 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1131482056 15:92790731-92790753 AAAAAAAAAAAAAATTGGTCGGG + Intronic
1131486033 15:92821261-92821283 AAGAAAAAGAAAAATAGGGCCGG - Intergenic
1132278948 15:100595930-100595952 CAGAAAAAATAAAATGGGTCTGG + Intronic
1132792545 16:1700071-1700093 CAGAAAAAAGTCAATTGTTCAGG + Exonic
1133044362 16:3078604-3078626 CAGAAGCAGAACAACTGGTTTGG - Intronic
1133186767 16:4105517-4105539 CAAAAAAAAAAAAATTGGCCGGG + Intronic
1133208029 16:4245797-4245819 AAGAAAAAGAAAAAATGGCCAGG - Intergenic
1133639452 16:7702718-7702740 CAAACACAGAACACTTGGTCTGG + Intronic
1133716343 16:8453074-8453096 CAGGAAAAAAAAAATTGGTGAGG + Intergenic
1133793182 16:9025333-9025355 CAAAAAAAGAATTATTGGCCGGG - Intergenic
1133897695 16:9945023-9945045 AATAAATAGAACAATTGGCCGGG + Intronic
1133901554 16:9980110-9980132 CAGAAAAAGAAAAATTAGCTGGG + Intronic
1133953592 16:10419881-10419903 CAGAAGCAGAACAACTGGTTTGG - Intronic
1134643135 16:15845359-15845381 CAGAAAAAGAAGAATTGTCTTGG - Intronic
1135477794 16:22792950-22792972 AACAAAAAGAAAAATGGGTCAGG + Intergenic
1135481811 16:22827000-22827022 CGGAGAAAGAATACTTGGTCTGG + Intronic
1135580074 16:23618001-23618023 AAGAAAAAGAAAAATTAGCCAGG + Intronic
1135594006 16:23727664-23727686 CAAAAAAAGAAAAATTAGTCGGG - Intergenic
1135711385 16:24720391-24720413 CAAAAAAAGAAAAAGAGGTCAGG + Intergenic
1136081536 16:27855421-27855443 CAGAAAAAGACCAACGGGGCCGG + Intronic
1136261561 16:29080934-29080956 AAGAAAAAGAAAAATTAGCCAGG - Intergenic
1136562993 16:31052102-31052124 AAGAAAAAGAAAAATTAGCCAGG - Intergenic
1136570957 16:31096366-31096388 CTGAAAAACAACCATTGGCCGGG - Intergenic
1137502890 16:49024926-49024948 CAGGAAGAGAAAAATTGGACAGG + Intergenic
1138673690 16:58635602-58635624 AAGAAAAAGAAAAATTAGCCAGG + Intergenic
1139454153 16:67058434-67058456 TAAAAAAAGAACTGTTGGTCGGG - Intronic
1139598588 16:67972319-67972341 CTGAAAAAGAAAAATTAGCCAGG + Intergenic
1139701185 16:68709073-68709095 CAGAAAAACAACAAATAGGCTGG - Intronic
1139761262 16:69186595-69186617 CATAAAAGGAACATTTGGTTAGG - Intronic
1139930819 16:70524677-70524699 CAAAAAAAGAAAAATTAGCCGGG - Intronic
1140212286 16:72979929-72979951 GAAAAAAAAATCAATTGGTCAGG + Intronic
1140266349 16:73424581-73424603 CAAAAAATGAAAAATTGGTGAGG + Intergenic
1141520106 16:84572911-84572933 CAAAAAAAAAAAAATTAGTCGGG - Intronic
1142536738 17:622849-622871 CAAAAAAAAAAAAATTAGTCGGG - Intronic
1144919007 17:18748067-18748089 CAGAAAATGAACACTTGCTTGGG + Exonic
1146101558 17:29987475-29987497 CAGAAGCAGAACAACTGGTTTGG - Intronic
1146635315 17:34499809-34499831 AAGACTAAGAAGAATTGGTCAGG + Intergenic
1146667510 17:34714968-34714990 CAGAGAAAGAAGAATGGGTAGGG + Intergenic
1147509056 17:41050072-41050094 CAGAATAACAGCAATTGTTCAGG + Intergenic
1147641707 17:42006312-42006334 CAAAAAAAAAAAAATTGGCCAGG - Intronic
1147724419 17:42557689-42557711 CAAAAAAATAAAAATTGGCCGGG + Intergenic
1147843321 17:43388076-43388098 CAAAAAAACAAAAATTAGTCAGG + Intergenic
1147873995 17:43607887-43607909 CAAAAAAAAAAAAATTAGTCTGG - Intergenic
1148146707 17:45370384-45370406 AAGAAAAAGAAAAATTAGCCGGG - Intergenic
1148639170 17:49172418-49172440 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1148713907 17:49701930-49701952 AAAAAAAAAAAAAATTGGTCAGG + Intronic
1148884296 17:50760329-50760351 CAGAAAAAGAAAAAAGGGTTGGG + Intergenic
1149891797 17:60396236-60396258 CAGAAAATAAAAAATTAGTCAGG - Intronic
1150109860 17:62489359-62489381 CAAAAAAAGAAAAATTAGCCGGG - Intronic
1150258589 17:63770267-63770289 CAGAAAAAAAAAAATTAGTCCGG - Intronic
1150399962 17:64848769-64848791 TAGAAAAAAAAAAATTGGCCAGG + Intergenic
1150569865 17:66376305-66376327 TAGTAAAAGAACAGGTGGTCTGG + Intronic
1151751780 17:76043101-76043123 CAAAAAAATAAAAATTGGCCTGG + Intronic
1152437611 17:80285969-80285991 CAAAAATAAAACAATAGGTCAGG - Intronic
1152478787 17:80536423-80536445 AAGAAAAAGAAAAATGGGGCCGG - Intergenic
1153698702 18:7669881-7669903 AAGAAAAAGAAAAATTAGCCGGG - Intronic
1153970456 18:10221682-10221704 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1153994774 18:10431216-10431238 CAGTAAAAGAATAAATGGTAGGG + Intergenic
1155127484 18:22893229-22893251 GATAAAAAGAACAATTCATCAGG + Intronic
1155893419 18:31294110-31294132 CAGAAAAAAAAAAATCAGTCAGG - Intergenic
1156359708 18:36373637-36373659 CAGCTAAAGAATAATTGTTCAGG + Intronic
1156716671 18:40020727-40020749 CAGAAAAAAAAAAATTTGCCTGG - Intergenic
1157450381 18:47782136-47782158 AAAAAAAAAAACAATTAGTCAGG + Intergenic
1157707147 18:49816694-49816716 TAGAAAAAGAATAATGGGCCAGG - Intronic
1157746363 18:50139317-50139339 CAGAAAAAAATCTCTTGGTCTGG + Intronic
1157898908 18:51494715-51494737 CAGAAAAAAAAAAATTAGCCAGG + Intergenic
1158355618 18:56615455-56615477 CAGAAAAAGAAAAAATGGGGGGG + Intronic
1158532540 18:58276503-58276525 CAGAAAATGAACACTAGGGCTGG - Intronic
1158773336 18:60548201-60548223 GAGATAAAGAAAAACTGGTCTGG + Intergenic
1159172862 18:64795530-64795552 CAGAAAATGAATTATTGTTCTGG - Intergenic
1159361770 18:67414684-67414706 CAAAAAAAAAAAAAATGGTCAGG - Intergenic
1159876578 18:73818260-73818282 CACAAAGAAAACAATTAGTCAGG + Intergenic
1160186932 18:76682995-76683017 TAGAAAAAGAAAAATTAGTCGGG - Intergenic
1160379751 18:78444588-78444610 AAGAAAAAGAAAAGTTAGTCAGG + Intergenic
1160773180 19:842882-842904 AAGAAGCAGAAAAATTGGTCGGG - Intronic
1160997628 19:1890914-1890936 AAAAAAAACAACAATTGGGCAGG - Intergenic
1161547450 19:4890401-4890423 GAGAAAAAGAAAAACTGGCCGGG - Intergenic
1161669349 19:5596503-5596525 CAAAAATAGAAAAATTAGTCAGG - Intronic
1161762046 19:6181061-6181083 AAGAAAAAGAAAAATTAGCCAGG + Intronic
1161779966 19:6285414-6285436 CAAAAAAAAAACAATTAGCCGGG + Intergenic
1162280977 19:9697807-9697829 CAGGATAAGAGCAATTGTTCAGG + Intronic
1162282830 19:9713282-9713304 CAGAAACAGAACAACTGATTTGG - Intergenic
1162640202 19:12002520-12002542 AAGAAAAAGAAAAAGTGGCCAGG - Intergenic
1162642863 19:12026092-12026114 CAGAAGCAGAACAACTGGTTTGG + Intronic
1162863820 19:13528627-13528649 CAGAAATACAACAAGGGGTCAGG - Intronic
1163304660 19:16470386-16470408 CAAAAAAAAAAAAATTGGACAGG + Intronic
1163555429 19:17989686-17989708 CAGAAAAAGAACAATTCCTCAGG - Intronic
1163812087 19:19439550-19439572 TAGCAAAAGGACAAGTGGTCAGG + Intronic
1163898960 19:20083908-20083930 TACAAAAAGAAAAATTGGCCAGG - Intronic
1163921056 19:20288935-20288957 TACAAAAAGAAAAATTGATCAGG - Intergenic
1164257131 19:23538042-23538064 CAGAAGCAGAACAACTGGTTTGG + Intronic
1164261801 19:23574312-23574334 CAGAAGCAGAACAACTGGTTTGG - Intronic
1164963671 19:32460248-32460270 AAGAAAAAGAAAAATTAGCCAGG + Intronic
1165264640 19:34649924-34649946 AAGAAGAAGAACAGATGGTCAGG - Intronic
1165490092 19:36118397-36118419 AAGAATAAAAAGAATTGGTCGGG + Intronic
1165564389 19:36712032-36712054 AAGAAAAAGAACAGGTGGACTGG - Exonic
1166059289 19:40315483-40315505 AAGAAAAAAAACAACTGGCCGGG + Intergenic
1166099719 19:40564674-40564696 CAGAAAATGAAAAATTAGTTGGG + Intronic
1166413513 19:42574090-42574112 CAGCAAAAAAACAATTTGTGAGG - Intergenic
1166551655 19:43669513-43669535 TAAAAAAAGAACACTTGGGCCGG + Intronic
1166658962 19:44632699-44632721 CAGAAGCAGAACAATTGGTTTGG - Intronic
1166770539 19:45279219-45279241 CAAAAAAAGAAAAAAAGGTCAGG + Intronic
1167201220 19:48066806-48066828 AAGAAAAAGAAAAATTAGCCAGG + Intronic
1167461732 19:49628427-49628449 CAAAAAAAAAAAAATTAGTCGGG - Intergenic
1167954373 19:53052408-53052430 CAGAAATATATAAATTGGTCGGG + Intergenic
1168628532 19:57938330-57938352 CAGAAAAAGATGAATAGGCCAGG - Intergenic
1202672854 1_KI270710v1_random:9302-9324 CAAAAGAAGAAATATTGGTCTGG - Intergenic
926995934 2:18736069-18736091 CAGGATAACAACAATTGTTCAGG + Intergenic
927045075 2:19270037-19270059 GAGAAAAAAAACCATTAGTCGGG - Intergenic
928148717 2:28806956-28806978 CAAAAATAGAACAATTGGCCGGG - Intronic
928301958 2:30133155-30133177 TAGAAAAGGAAAAATTGGGCTGG + Intergenic
928702756 2:33915812-33915834 CAGAAGCAAAACAATTGGTTTGG - Intergenic
928823822 2:35394574-35394596 CAGGAAAAGAACAAGTGCTGGGG - Intergenic
928861639 2:35864488-35864510 CAGGAAAAGAACAATTATTGAGG + Intergenic
928962070 2:36937371-36937393 AAGAAAAAGAAAAAGAGGTCGGG + Intronic
929664863 2:43826134-43826156 AAGAAAAAGAAAAATTAGCCAGG - Intronic
930324712 2:49900811-49900833 CAGGAAAAAAACAATTGGCCAGG + Intergenic
930957077 2:57216508-57216530 CCAAAAAAGATAAATTGGTCAGG + Intergenic
931171587 2:59809107-59809129 CAGAAGAAGAAGAATTGTTTTGG - Intergenic
931276420 2:60747519-60747541 CTCAAAAAGAAAAATTGGTTGGG + Intergenic
931677107 2:64708290-64708312 TAGAAAATGAACAATTGGCAGGG - Intronic
931679221 2:64729304-64729326 GAGAAAAAGTACATTTGGGCTGG - Intronic
932106692 2:68949713-68949735 CAGAAAAAGAACAATTGGTCAGG - Intronic
934584100 2:95474505-95474527 CAGAAAAATAACCCTTGGTGAGG - Intergenic
934595352 2:95602209-95602231 CAGAAAAATAACCCTTGGTGAGG + Intergenic
934787419 2:97023325-97023347 CAGAAAAATAACCCTTGGTGAGG - Intergenic
934882677 2:97996844-97996866 AAGAAAAAGAAAAATTGGCGTGG - Intergenic
935080030 2:99783730-99783752 CAGAAAAAGAAAGAATGGTCAGG + Intronic
935100007 2:99985147-99985169 CAGAAAAAGTAAATTTGGTTTGG - Intronic
936468040 2:112771292-112771314 GATAAAAAGAAAAATTGGTGAGG + Intergenic
936544667 2:113380735-113380757 CAAAAAAAAAAAAATTAGTCAGG + Intergenic
936687213 2:114841824-114841846 AAGACAAAGAAGAATTGGTTAGG + Intronic
936799907 2:116254352-116254374 CAGAAGCAGAACAATTGATTTGG + Intergenic
937061519 2:118983498-118983520 CATAAAAAACACAATTGCTCTGG - Intronic
937201690 2:120208224-120208246 CAGAAAGACAAAAATTAGTCAGG + Intergenic
937423053 2:121774529-121774551 CAGAAAAAGAAAAGTGGGCCGGG + Intergenic
937662340 2:124445248-124445270 CAGAAAAAAAAAAATTAGCCAGG - Intronic
937817200 2:126264422-126264444 GAAAAAAAGAAAAATTGGCCAGG + Intergenic
939246142 2:139625766-139625788 CAGGATAAGAGCAATTGTTCAGG - Intergenic
940122377 2:150281302-150281324 CAGAGGAGGAACATTTGGTCAGG + Intergenic
940140814 2:150488631-150488653 TAGAAAAAGAACAAATGTGCGGG - Intronic
940334574 2:152511986-152512008 CAGAATAAGAACACTTTCTCTGG + Intronic
940608205 2:155955187-155955209 CACAAAAAGAACAATTAGGAAGG + Intergenic
940743172 2:157535530-157535552 CAAAAATATAACAATTGGCCAGG + Intronic
942787477 2:179716379-179716401 CAGAAAATGGAAAATAGGTCAGG - Intronic
943122117 2:183749499-183749521 CAAAAACAGAAAAATTAGTCTGG - Intergenic
943840464 2:192573985-192574007 CCCAAAAAGAAAAATTGCTCAGG - Intergenic
944007648 2:194930151-194930173 CAAAAAAAAAAAAATTAGTCGGG + Intergenic
944564194 2:200970815-200970837 CAGAAAAAAAAAAATTAGTCGGG + Intergenic
944592586 2:201231785-201231807 AAGAAAAATAATAATTGGTGAGG + Intergenic
944747525 2:202673411-202673433 CAGAAAAAGAAAAATAGGGTAGG - Intronic
945415922 2:209572897-209572919 GTGATAAAGAACAACTGGTCAGG - Intronic
945645138 2:212482775-212482797 CAAAAAAAGAAAAATTTGCCGGG - Intronic
946018644 2:216623968-216623990 CAGAAATACAAAAATTAGTCAGG + Intergenic
946296375 2:218786953-218786975 CAAAAATAGAAAAATTGGCCAGG - Intronic
946350849 2:219150965-219150987 CAGAAAAAAAAAAATTAGCCAGG + Intronic
946505849 2:220299886-220299908 TAAAAATAGAAAAATTGGTCAGG + Intergenic
946769506 2:223074323-223074345 CATAAAAAGATCAAATGGTCTGG - Intronic
946877174 2:224140765-224140787 CAGAAAAAAAAAAATTAGCCAGG - Intergenic
947080506 2:226390791-226390813 CAGAAACAGAACAAAAGGACTGG + Intergenic
947379916 2:229535640-229535662 CAGAAAAAAAAAAATCAGTCTGG - Intronic
1169133735 20:3182901-3182923 CAAAAATACAAAAATTGGTCGGG + Intergenic
1169163437 20:3402736-3402758 CAAAAAAAGAAAAATTAGCCAGG - Intronic
1169372903 20:5042422-5042444 AAGAAAAAGAAAAATTAGCCAGG - Intergenic
1169467358 20:5853192-5853214 TAGAAAATAAACAAATGGTCGGG + Intronic
1169493421 20:6090591-6090613 CAAAAAAAGAAAAATTAGCCAGG + Intronic
1169582227 20:7036522-7036544 GAGAAAGAGAACAATTTGTCTGG + Intergenic
1169621916 20:7516831-7516853 CAGAAAAAGAACAACTTATGTGG - Intergenic
1170273744 20:14558606-14558628 TATAAAAAGAACAATTTATCAGG + Intronic
1170731178 20:18976221-18976243 CAGAACAAGAACAATTGCCAGGG - Intergenic
1170777168 20:19385928-19385950 CAGAAATAGAAAAATAGGCCAGG - Intronic
1170985707 20:21256348-21256370 CAAAAATAGAAAAATTAGTCAGG + Intergenic
1171072075 20:22080355-22080377 CAAAAAAAAAAAAATTAGTCTGG + Intergenic
1171143614 20:22763665-22763687 CAGGAAAAGAGCCATGGGTCAGG + Intergenic
1171229512 20:23472276-23472298 CAGAAATAGAACAACTGATTTGG + Intergenic
1171777403 20:29381996-29382018 CAGGATAAGAGCAATTGTTCAGG + Intergenic
1171887040 20:30662173-30662195 CAAAAAAAAAAAAATTAGTCTGG - Intergenic
1171995420 20:31727169-31727191 CAGAAAAAGAACAATTAGCCAGG + Intergenic
1172014136 20:31862987-31863009 CTGAAAAAGAACAGATGCTCAGG - Intronic
1172368356 20:34366822-34366844 CAAAAAAAGAAAGATTGCTCTGG + Intronic
1172712500 20:36936819-36936841 CAAAAAAAGAAAAATTAGCCAGG - Intronic
1172815676 20:37684010-37684032 AAGAAAAAGAAAAGCTGGTCAGG - Intergenic
1173728488 20:45312845-45312867 AAGAAAAAGAAAAATTAGCCTGG + Intronic
1174232819 20:49060478-49060500 AAGAAAAAAAAAAATTGGACAGG + Intronic
1174938047 20:54893757-54893779 CAAAAAAATAACAATTAGTCAGG - Intergenic
1175086935 20:56467652-56467674 AAGAAAAAGAAAAATTAGCCAGG - Intergenic
1176202432 20:63867931-63867953 AAAAAAAAGAAAAACTGGTCGGG - Intronic
1176634196 21:9173713-9173735 CAAAAGAAGAAATATTGGTCAGG - Intergenic
1176639112 21:9281076-9281098 CAAAAGAAGAAATATTGGTCTGG + Intergenic
1177618101 21:23551279-23551301 AAGAAAAATAACAAGAGGTCAGG - Intergenic
1177906669 21:26979637-26979659 AAGTAAAAGAATAATTGGTCTGG - Intergenic
1177909613 21:27014644-27014666 CAGCAAAGGAAAAATTGGTTTGG - Intergenic
1178536366 21:33413426-33413448 CAGAAGAAGAGCCAGTGGTCAGG + Intronic
1180209094 21:46283218-46283240 CAGAAAAAGTGAAATTGGCCGGG - Intronic
1180350071 22:11793568-11793590 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1180372418 22:12053919-12053941 CAAAAGAAGAAATATTGGTCTGG + Intergenic
1180374355 22:12077013-12077035 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1180388135 22:12198684-12198706 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1180423158 22:12888583-12888605 CAAAAGAAGAAATATTGGTCTGG + Intergenic
1181262336 22:21607352-21607374 CAAAAAAAAAAAAATTAGTCGGG + Intronic
1181602185 22:23959215-23959237 CAGGAAAAGGACAAGAGGTCAGG - Intronic
1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG + Intronic
1181663789 22:24375443-24375465 GGGATAAAGAACACTTGGTCAGG - Intronic
1181789047 22:25249047-25249069 AAGAAAAACAAAACTTGGTCTGG - Intergenic
1181870733 22:25897028-25897050 GAGAAAAAGAAAGATTGCTCGGG - Intronic
1181926744 22:26365711-26365733 CAAAAAAAAAAAAATTAGTCAGG + Intronic
1182505053 22:30776090-30776112 AAGAAAAAGAAAAATGAGTCTGG - Intronic
1183592849 22:38790870-38790892 TAGAAAAAGTACAGTTGGCCGGG + Intronic
1184289073 22:43488692-43488714 CAGAAAAGGAAAATTTGCTCTGG + Intronic
949177178 3:1079001-1079023 CAGAAAATAAACAATTTATCTGG + Intergenic
949479916 3:4483965-4483987 CAGAAAAAGCAAAATGGGCCTGG - Intergenic
949781252 3:7691387-7691409 AAGAAAAAGAAAAACTGGACTGG + Intronic
949997376 3:9628987-9629009 CAAAAAAACAGCATTTGGTCCGG - Intergenic
950055882 3:10024091-10024113 CAGGGAAAGAACAAGTGGGCTGG - Intergenic
950817903 3:15726409-15726431 CAGAGAAAGTACTAGTGGTCTGG + Intronic
951736153 3:25867257-25867279 CAGAAAAATAATAATTGCCCTGG - Intronic
952381404 3:32808269-32808291 CAAAAAAAGAAAAAAAGGTCAGG + Intergenic
952577798 3:34795653-34795675 CAGACTAAGAACTATAGGTCTGG - Intergenic
952617174 3:35288302-35288324 CAGAAATAGAACATTTTGACAGG + Intergenic
952812043 3:37412669-37412691 CAGAATAAGAAAAATAGGCCAGG + Intronic
953449079 3:42991299-42991321 AAGAAAAAGACCGATTGGCCAGG - Intronic
954065368 3:48101659-48101681 CAAAAAAAGAAAAATTAGCCAGG + Intergenic
954232922 3:49232409-49232431 CAGAAGCAGAACAACTGGTTTGG + Intronic
954233897 3:49240517-49240539 TAGAAATACAAAAATTGGTCGGG - Intronic
954299696 3:49693650-49693672 CAAAAAACTAAAAATTGGTCAGG - Intronic
954728673 3:52638754-52638776 AAGAAAAAGAAAAATTAGCCGGG - Intronic
954888242 3:53896964-53896986 CAGGAAAACAGCAATTGTTCTGG - Intergenic
955329088 3:58032087-58032109 GAAAAAAAGAAAAATTAGTCAGG - Intronic
955346763 3:58167410-58167432 CAGAGAAAGAATTATTGTTCTGG - Intronic
955362261 3:58285629-58285651 GAGAGAAACAACATTTGGTCTGG + Intronic
955453162 3:59092434-59092456 GAGACAAAGAACAATTGTTGGGG - Intergenic
955455988 3:59122269-59122291 AAGAAAAAGAAAAAACGGTCAGG + Intergenic
955683691 3:61528639-61528661 CAAAAATACAACAATTGGCCAGG - Intergenic
956684758 3:71815624-71815646 CTCAAAAACCACAATTGGTCAGG + Intergenic
957099104 3:75806377-75806399 CAGAAGCAGAACAACTGGTTTGG - Intergenic
957101093 3:75829741-75829763 CAAAAGAAGAAATATTGGTCTGG - Intergenic
957355999 3:79087433-79087455 GAGAGAAAGAAAAATTGGTTAGG - Intronic
957687119 3:83515851-83515873 CATAAAATGAACAAATGTTCAGG + Intergenic
957732362 3:84155628-84155650 CAGAAAAAGAGAAATAGGTAAGG + Intergenic
957747374 3:84362959-84362981 AAGAAAAAGACAAATTGGCCGGG - Intergenic
958929479 3:100193669-100193691 CAAAAAAAGAAAAATTAGGCTGG - Intronic
959008798 3:101050434-101050456 CAGAAAAAAGACAGTTGGTCAGG - Intergenic
959036034 3:101365338-101365360 CAAAAAAAGAACTTTTGGCCGGG + Intronic
959186519 3:103053321-103053343 GAGAAAAAGAACAATTCCACTGG - Intergenic
959198354 3:103214168-103214190 CAGAAACAGAACAACTGGATTGG + Intergenic
959276486 3:104283193-104283215 CAGAAGCAGAACAACTGGTTTGG - Intergenic
959678162 3:109060850-109060872 CAGAAAAAGACTAATGGGTCAGG - Intronic
959745573 3:109772743-109772765 TAGAAAAAGAAAAATTAGACTGG + Intergenic
959789555 3:110342770-110342792 AACAAAATGAACAACTGGTCTGG + Intergenic
961056486 3:123793373-123793395 CAGAAAAAGAAGACGCGGTCCGG - Intronic
961717612 3:128869506-128869528 CAGGGAAAGAACAAGTGGGCTGG - Intergenic
961859656 3:129905525-129905547 CAGAAGCAGAACAACTGGTTTGG + Intergenic
962516803 3:136159974-136159996 AAGAAAATGAAAAAATGGTCAGG + Intronic
963194600 3:142512569-142512591 AAGAAAAAACACAATTGGCCAGG + Intronic
963273490 3:143308111-143308133 CAGAAACAGAATCAGTGGTCAGG - Intronic
963584607 3:147169653-147169675 CAGAAAAAAAAAAATTAGCCTGG + Intergenic
963643929 3:147890131-147890153 CAGACAAAGAATAATGGGCCTGG + Intergenic
963846640 3:150165563-150165585 CAAAAAGAGAACAATGGGCCAGG - Intergenic
963995656 3:151705533-151705555 CAGAAGCAGAACAACTGGTTTGG + Intergenic
964065880 3:152578378-152578400 CTAAAAAACAACAATTTGTCTGG + Intergenic
964209432 3:154210946-154210968 CAAAAAAAAAAAAATTTGTCTGG + Intronic
965988458 3:174786153-174786175 CTGAAAAAGTAAAATTGGCCAGG + Intronic
966206874 3:177413774-177413796 TAGAAAAAGAAAAGTTGGCCGGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966978650 3:185109252-185109274 CAGAAGCAAAACAATTGGTTTGG + Intronic
967111061 3:186294372-186294394 CAAAAAAAGAAAAATTAGCCTGG + Intronic
967207501 3:187137515-187137537 AAGAAAAAGAAAAATTGGCCGGG + Intronic
967661579 3:192117066-192117088 CAGAAAAAAAACAGTATGTCTGG - Intergenic
968126101 3:196161592-196161614 CTAAAAAAGAAAAATTGGCCAGG + Intergenic
1202747783 3_GL000221v1_random:123943-123965 CAAAAGAAGAAATATTGGTCTGG - Intergenic
968786289 4:2624437-2624459 AAGAAAGAGAACACTTGGCCGGG - Intronic
970324640 4:14910782-14910804 CAGATAAAGAGAAATTAGTCTGG + Intergenic
971416776 4:26439041-26439063 AAGATACAGAACAATTAGTCAGG - Intergenic
971546129 4:27889942-27889964 CATAAAAAGAACACTGGGGCAGG - Intergenic
971709894 4:30097461-30097483 CAAACAATGAACAATTGGCCGGG + Intergenic
971775316 4:30956051-30956073 CAAAAAAAAAACAATTAGCCAGG + Intronic
972046963 4:34678112-34678134 TAGAGAAAGAACAATTGGTGAGG - Intergenic
972588556 4:40461772-40461794 CAGAAATACAAAAATTAGTCGGG + Intronic
972847411 4:43006278-43006300 CAGGATAAGAGCAATTGTTCAGG + Intronic
973008880 4:45047290-45047312 CAGAAGCAGAACAACTGGTTCGG + Intergenic
973154205 4:46928710-46928732 GAGAAAAAGAACAAATGCTTTGG - Exonic
974351143 4:60748146-60748168 CAAAAAAATAAAAATTGCTCAGG + Intergenic
974591901 4:63962016-63962038 CAGAACAAGAACAATATGGCAGG - Intergenic
974636293 4:64567848-64567870 CAGAAGCAGAACAACTGGTTTGG + Intergenic
975210527 4:71694798-71694820 GACAAAAAGAACAAATGGTTTGG - Intergenic
975886235 4:78968875-78968897 CAAAAAAAGAAAAATTAGCCAGG - Intergenic
976345546 4:83995847-83995869 CATTAAAAGAACAATTGCACAGG - Intergenic
977306469 4:95329128-95329150 CAAAAAATGAAAAATTAGTCAGG + Intronic
977652683 4:99488153-99488175 CAGAAGCAGAACAACTGGTTTGG - Intergenic
977880072 4:102194012-102194034 CAGAGACAGAGCAATTGTTCAGG - Intergenic
977915649 4:102589707-102589729 CAGAAATAGAATAATTGTTAAGG + Intronic
977940085 4:102848347-102848369 CAAAAAAAGAAAAATAGGCCGGG + Intronic
977958298 4:103055652-103055674 CAGAAAAAAAAAAACTGTTCAGG + Intronic
978516936 4:109578658-109578680 TAAAAAAAGAAAAATTGGCCAGG - Intronic
978708043 4:111740509-111740531 CAGAAAAAGAAGAATATGACTGG - Intergenic
979195861 4:117919524-117919546 CAGGATAACAACAATTGTTCAGG + Intergenic
979558036 4:122073322-122073344 AAGAAAAAGAATAAATGGTTAGG + Intergenic
979982418 4:127273168-127273190 CAGAAGCAGAACAACTGGTTAGG - Intergenic
980053218 4:128058238-128058260 CAAAAAAAGAAAAATTAGTCAGG + Intergenic
980297809 4:130944966-130944988 CAGAAGGAGAACAACTGGTTTGG + Intergenic
981425480 4:144597548-144597570 CGGATAAAGAACAAATGGTTTGG - Intergenic
981554545 4:145978548-145978570 CAGAAAAAGAGCAATTTGGAAGG - Intergenic
981642633 4:146962858-146962880 CAGAAAACAAACAAATGGCCCGG + Intergenic
982270369 4:153579769-153579791 CAGAAAAAAAAGAATAGGTCAGG - Intronic
983139139 4:164126476-164126498 CAGAAATAGAAAAATTGGTATGG + Intronic
983416557 4:167463307-167463329 AAGAAAAATAACAATAGGGCTGG - Intergenic
984170090 4:176348977-176348999 CAGAAGCAGAACAACTGGTTTGG + Intergenic
984604121 4:181764849-181764871 CATAAAAATAAAAATTAGTCGGG - Intergenic
984824817 4:183915118-183915140 CAGAAAAAGAAAACTTGGCCTGG - Intronic
984956043 4:185046443-185046465 CAGAAGCAGAACAATTGATTTGG - Intergenic
985173704 4:187178377-187178399 CAGCAAAAGAGCTATTGGCCTGG - Intergenic
985187255 4:187331119-187331141 CAGAAAAAGAACAATGATTGTGG + Intergenic
985267762 4:188165864-188165886 CAGAAAAAGAAAATTTAGGCCGG - Intergenic
985283589 4:188311713-188311735 CAAAATAAAAACAATTGGGCCGG + Intergenic
1202754009 4_GL000008v2_random:39489-39511 CAAAAGAAGAAATATTGGTCTGG + Intergenic
1202755938 4_GL000008v2_random:62452-62474 CAGAAGCAGAACAACTGGTTTGG + Intergenic
985501238 5:248073-248095 CAGAAGCAGAACAACTGGTTTGG + Intronic
985735650 5:1579564-1579586 CAGAAGCAGAACAACTGGTTTGG - Intergenic
986586508 5:9323820-9323842 CAGAAATATAAAAATTAGTCAGG - Intronic
988017057 5:25572553-25572575 CAGAAAAGGTAAAAATGGTCTGG + Intergenic
988593478 5:32569218-32569240 AAGAAAAAGAAAAATTAGCCTGG - Intronic
988809308 5:34768670-34768692 AAGAAAAAGAGCAAATGCTCTGG + Intronic
988810830 5:34783529-34783551 CAGAAGCAGAACAACTGGTTTGG - Intronic
989751423 5:44898909-44898931 AAGAAAAAGAAAAAATGGCCGGG + Intergenic
989758948 5:44989223-44989245 CAGAAGCAGAACAATTGGTTTGG + Intergenic
990346384 5:54875938-54875960 CAGGATAAGAGCAATTGTTCAGG + Intergenic
990395631 5:55375529-55375551 CAGGATAAGAGCAATTGTTCAGG - Intronic
990752486 5:59032100-59032122 CACAAAAAGATAAATTGGTGAGG + Intronic
990876349 5:60490750-60490772 CAATAAAAGAAAAATTGCTCAGG + Intronic
991016059 5:61933898-61933920 AAGAAACAGAAAAATTTGTCAGG - Intergenic
991315889 5:65305910-65305932 GAGTAAAAGAACAAGTGATCAGG - Intronic
991688648 5:69205672-69205694 CAGAAAAAAAACAATTAGCCAGG - Intronic
992282671 5:75198042-75198064 CAGAAAGAGTACCAGTGGTCAGG - Intronic
992517780 5:77512753-77512775 AAAAAAAAAAAAAATTGGTCAGG + Intronic
992719873 5:79550369-79550391 CAGAAAAAGAAAAATTTACCAGG + Intergenic
993652237 5:90535989-90536011 CAGAAAAAAAAAAATTAGCCAGG + Intronic
995387611 5:111605260-111605282 CAGAAAAAGACCAATATGGCTGG + Intergenic
995616170 5:113966725-113966747 CAAAAAAACAAAAATTGGCCAGG - Intergenic
995711227 5:115037831-115037853 CAGAAGCAGAACAACTGGTTTGG - Intergenic
995883564 5:116868837-116868859 CAGAAAAAAAAAAATTAGCCGGG - Intergenic
996389048 5:122940288-122940310 TAGAAAATGAAAAATTAGTCTGG - Intronic
996457179 5:123698184-123698206 CAAAAAAAGAATAAGTTGTCTGG - Intergenic
997702758 5:135915528-135915550 CAGAAAATGGACAATAGATCAGG - Intergenic
997925437 5:138026642-138026664 AAAAAAAAAAAAAATTGGTCAGG + Intronic
998931837 5:147189788-147189810 CAGAAAAAGAAGAATTGTCTTGG + Intergenic
999992765 5:157064358-157064380 AAGAAAAAGAAAAATTAGCCAGG + Intergenic
1000120556 5:158194024-158194046 CACTGAAAGAAAAATTGGTCTGG + Intergenic
1000495337 5:161975932-161975954 CAGAAAAAAAACAAATTGTCTGG + Intergenic
1001163407 5:169341584-169341606 GAGAAAAAGAATGATTGGCCAGG - Intergenic
1002781066 6:366492-366514 CAGAAAAATAGCAAGTGGTTTGG + Intergenic
1002970032 6:2006124-2006146 CAGAAACATAAAAATTGGCCAGG + Intronic
1003422409 6:5970266-5970288 TAGAAAAATCACAATTGGCCGGG + Intergenic
1003789970 6:9534899-9534921 ATAAAAAAGAACAATTGGCCGGG - Intergenic
1004080190 6:12384636-12384658 CAGAAAAAAAAAAAGTGGGCAGG - Intergenic
1004255159 6:14057134-14057156 AAGAAAAAGAAAAATTGGCCAGG + Intergenic
1004279282 6:14267179-14267201 CAGAAATAGAAGAGTTGGTTTGG + Intergenic
1004409671 6:15369346-15369368 ATCAAAAAGAGCAATTGGTCAGG - Intronic
1004484682 6:16055073-16055095 AAAAAAAAAAAAAATTGGTCTGG + Intergenic
1005000588 6:21236549-21236571 CTCAAAAAGAAAAAGTGGTCTGG - Intergenic
1005079695 6:21944623-21944645 CAAAAAAAAAAAAATTGGCCAGG - Intergenic
1005747815 6:28855304-28855326 TAGAAAAAGGACAATTGGCTGGG - Intergenic
1005857920 6:29877276-29877298 CAGAAACAGAACAACTGATTTGG - Intergenic
1005943030 6:30575361-30575383 TAAAAAAAAAAAAATTGGTCGGG - Intronic
1006112375 6:31755655-31755677 CAAAAAATAAAAAATTGGTCAGG - Intronic
1006211256 6:32396817-32396839 CAGAAATACAAAAATTAGTCGGG + Intronic
1006359992 6:33582104-33582126 AAAAAAAAAAAAAATTGGTCGGG + Intergenic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1006720800 6:36149025-36149047 CAGAATAACAGCAATTGTTCAGG - Intergenic
1006772338 6:36564137-36564159 CACAAAAACAAAAATTAGTCGGG - Intergenic
1006998334 6:38284292-38284314 CAGGAAAAGAAAAATTGTTTGGG + Intronic
1007088198 6:39165575-39165597 AAGAAAAAGAAAAATTAGCCAGG - Intergenic
1007886867 6:45239998-45240020 CAGAAGCAGAACAACTGGTTTGG + Intronic
1008178652 6:48300518-48300540 AAGAAAAAGAAAAATTGATTTGG - Intergenic
1008742769 6:54629909-54629931 CTCAAAAAGAACAAATGGTCTGG + Intergenic
1009595692 6:65732681-65732703 CACAAAAAGAAATAGTGGTCAGG + Intergenic
1010547942 6:77181893-77181915 CAGAAAGTGAACAATTGCTCTGG - Intergenic
1011281520 6:85682575-85682597 AAAAAAAAAAAAAATTGGTCAGG - Intergenic
1011467836 6:87676779-87676801 TAAAAAAAAAACAATTGGCCGGG + Intronic
1011722131 6:90168195-90168217 CAAAAATAGAAAAATTAGTCAGG + Intronic
1011985575 6:93439882-93439904 AAGAAAAAGAAAAAATGGTGTGG - Intergenic
1012460660 6:99456787-99456809 CAGAATAACAGCAATTGTTCAGG + Intronic
1013208158 6:107963167-107963189 TAGAAAAAGAACAATAGGTTGGG - Intergenic
1013254172 6:108367613-108367635 CAGAAAAAGCAGATTTGGTTAGG + Intronic
1013519634 6:110921305-110921327 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1013649232 6:112177117-112177139 TAGAAAAAGAATATTTTGTCAGG + Intronic
1014026190 6:116648807-116648829 CAGAAAAAAAAAAATTAGCCAGG + Intronic
1014919793 6:127200461-127200483 CAGAAAGAGAACAGTAAGTCTGG + Intergenic
1015629818 6:135220862-135220884 AAGAAAAAAAAAGATTGGTCTGG - Intergenic
1016418455 6:143858228-143858250 CAGAAGAAGAGTAATTGGTTAGG + Intronic
1016891050 6:149007278-149007300 AAAAAAAAAAAAAATTGGTCGGG - Intronic
1017994134 6:159516980-159517002 CACAAAAAGAACAAAATGTCGGG - Intergenic
1018255746 6:161917096-161917118 AAGAAAAAGAAAAATTAGGCTGG - Intronic
1018325297 6:162661263-162661285 AAAAAAAAGAACAAGGGGTCAGG + Intronic
1018572930 6:165229774-165229796 CAGAGAAAGATCAAGTGGTGAGG + Intergenic
1019013480 6:168861876-168861898 CAGAATATGAACAATTTCTCAGG + Intergenic
1019774331 7:2903515-2903537 AAGATAAAGAACTATTGCTCTGG - Intergenic
1020236096 7:6356709-6356731 AAGAAAAAAAACAATTAGGCTGG + Intergenic
1020455670 7:8371666-8371688 CAGAGAAAGACCATTTGGTGGGG + Intergenic
1020456479 7:8379381-8379403 GAGAAATAGAACATCTGGTCTGG - Intergenic
1020563690 7:9768767-9768789 CAGGAAAAGAAGAAATGGTGGGG + Intergenic
1020603041 7:10300519-10300541 CAGAAGAGAAACAATTGGTTGGG - Intergenic
1020859458 7:13472756-13472778 AAGAAAAAGAAAAATTAGCCAGG + Intergenic
1021089605 7:16467733-16467755 CAGAAAAAGAAAAAGTAGTGAGG - Intronic
1021314165 7:19125713-19125735 CAGAAAAGGAAGAGTTGCTCTGG - Intergenic
1022142151 7:27501719-27501741 AAAAAAAAGAAGAATTGGTTAGG - Intergenic
1022163109 7:27731704-27731726 CAAAAAATGAAAAATTAGTCAGG + Intergenic
1023009240 7:35910834-35910856 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1023110431 7:36805657-36805679 CAGAAAAAAAAAAATTAGCCGGG - Intergenic
1024101821 7:46039911-46039933 CAGAAACAGAACAACTGATTTGG - Intergenic
1024271813 7:47648290-47648312 GAGAAAAAGGACAATTCTTCAGG - Intergenic
1024686637 7:51752859-51752881 CAGAAGGAGAAGACTTGGTCAGG + Intergenic
1024752187 7:52479648-52479670 TAGAATAAGAACTATTGTTCTGG - Intergenic
1025085246 7:56018358-56018380 CAAAAAAAAAACAATGGGTAGGG + Intronic
1025122910 7:56320986-56321008 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1025166397 7:56715989-56716011 TAGAAAAAGAACACTTGGATGGG - Intergenic
1025819517 7:64949014-64949036 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1025962706 7:66237599-66237621 CAGAAAAACAACCAGTAGTCAGG + Intronic
1026034190 7:66819308-66819330 AAAAAAAAGAAAAATAGGTCAGG - Intergenic
1026056770 7:66991636-66991658 CAAAAAAAGAAAAATTAGCCGGG + Intronic
1026091612 7:67304998-67305020 CAAAAACAGAATAATTAGTCAGG - Intergenic
1026369409 7:69683748-69683770 CCAAAAAACAAAAATTGGTCTGG + Intronic
1026643728 7:72149960-72149982 CAGAAAAAAAAAAATTAGCCAGG + Intronic
1026721326 7:72833408-72833430 CAAAAAAAGAAAAATTAGCCGGG - Intergenic
1026962803 7:74419816-74419838 CAGAAAGAGGACAGTTTGTCAGG - Intergenic
1027156908 7:75774922-75774944 TAAAAAAAGAATTATTGGTCGGG + Intronic
1027719240 7:81718222-81718244 CAGAAAAATGAAACTTGGTCTGG - Intronic
1028779886 7:94724052-94724074 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1029304601 7:99609727-99609749 AAAAAAAAGAACAAGTGGCCGGG - Intergenic
1029377084 7:100185203-100185225 CAAAAACAGAATAATTAGTCAGG - Intronic
1029475197 7:100779206-100779228 AAAAAAAAAAAAAATTGGTCGGG + Intronic
1029919825 7:104251400-104251422 TAGAAAAAGAACTATTAGCCAGG - Intergenic
1030819706 7:114081536-114081558 GAGACAAAGATCAATTGCTCTGG - Intergenic
1030976529 7:116130771-116130793 CAAAAAATGAAAAATTAGTCTGG - Intronic
1031009888 7:116514852-116514874 CATAAAAAGAACAATTTCTTAGG - Intergenic
1031914635 7:127551699-127551721 CTAAAAAAGAACAACTGGGCTGG + Intergenic
1032707479 7:134433724-134433746 CAGAAAAATAACAAGTTGTAAGG + Intergenic
1033272268 7:139943271-139943293 CAGAAAATGGGCAACTGGTCAGG - Intronic
1033302087 7:140195556-140195578 AAGAAAAAGAAAAATTAGTCTGG - Intergenic
1033851787 7:145505089-145505111 CAGAATAAAAACAATGGGCCAGG - Intergenic
1035210378 7:157323644-157323666 TAAAAAAAGAAAAATTGGTTGGG - Intergenic
1035613962 8:988800-988822 CAGAAAAAGCAGGATTGGTCAGG - Intergenic
1037811303 8:22088833-22088855 AAAAAAAAAAACAATTGGCCAGG + Intergenic
1039045046 8:33442108-33442130 CAGAAAAACAAAAATTAGCCGGG - Intronic
1039515098 8:38126040-38126062 CAGAAATAGAAAAATTAGCCAGG + Intronic
1039526506 8:38221003-38221025 TAAAAAAAGAACAATTGGCTGGG - Intergenic
1039664632 8:39511529-39511551 CAGAAAAAGAAAAATACGTGAGG - Intergenic
1039692014 8:39874201-39874223 CAGAAGCAAAACAATTGGTTTGG + Intergenic
1039698322 8:39936484-39936506 CAGAAAAAGAAAAATTAATAGGG + Intronic
1040016009 8:42700614-42700636 CAGAAAAGAAATAATTGGGCCGG - Intronic
1040956037 8:52980819-52980841 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1041019297 8:53622304-53622326 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1041062623 8:54050531-54050553 CAGAGAAAGAACTATAGGACAGG - Intronic
1041610161 8:59836679-59836701 AAGAAAGAAAACAGTTGGTCAGG - Intergenic
1041741032 8:61156787-61156809 TAGGAAAATAAAAATTGGTCAGG + Intronic
1042278468 8:67029445-67029467 CAGAAGAAGAACAATAGTACAGG + Intronic
1043191479 8:77228040-77228062 CAAAAAAAAAAAAATTAGTCAGG - Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1044012939 8:87017120-87017142 CAGAAAAGGTAAAATTGGTCTGG + Intronic
1044373122 8:91437346-91437368 CATAAAAAGAACAATTACTAGGG + Intergenic
1044442738 8:92240928-92240950 CAGAAACAGAACAACTGATTTGG + Intergenic
1045075377 8:98560735-98560757 CAGAAAAACAAAATTTGGCCAGG + Intronic
1045280732 8:100747428-100747450 CAGAAAATAAAAAATTAGTCAGG + Intergenic
1045599472 8:103696135-103696157 AAGAAAAAGAAAAATAGGTGGGG - Intronic
1045873239 8:106949559-106949581 CAGAAAAAGAACAAAGTGTCTGG + Intergenic
1045889210 8:107134668-107134690 GAGAAAAAGAAAAATTAGCCAGG - Intergenic
1046066840 8:109207467-109207489 CTGAAAAATAACTATTGGTCTGG + Intergenic
1046332070 8:112730721-112730743 AACAAAAAAAACAATTGATCTGG - Intronic
1046339629 8:112836234-112836256 CAGGAGAAGAAAAATGGGTCTGG + Intronic
1046861673 8:119099774-119099796 CAGAAAAAGAAAAGATGGTGTGG - Intronic
1047472661 8:125193623-125193645 CTGAGAAAGAACTATTGGTTAGG + Intronic
1048077744 8:131091649-131091671 AAGAAAAAAAAAAATTGGCCGGG - Intergenic
1049500883 8:142964782-142964804 CAGGATAACAACAATTGTTCAGG - Intergenic
1050013683 9:1210904-1210926 CAGAAGGAGAACAAGAGGTCAGG - Intergenic
1051405818 9:16736767-16736789 GAAAAAAAAAACAATAGGTCGGG - Intronic
1051470627 9:17436745-17436767 CAGGAAAAAAACAATGGCTCTGG - Intronic
1051633240 9:19159196-19159218 CAAAAAATGAAAAATTGGCCAGG - Intergenic
1052291532 9:26846980-26847002 AAGAAGAAGAAAAATTGGCCGGG - Intronic
1052572305 9:30242283-30242305 AACAAAAAAAACAATTAGTCGGG - Intergenic
1052821945 9:33144532-33144554 CAGAAAAAGAGAAAATGGGCTGG - Intronic
1052944410 9:34156458-34156480 AAAAAAAAAAAAAATTGGTCAGG - Intergenic
1053213753 9:36254042-36254064 AAGAAAAAGAAAAATTAGCCAGG + Intronic
1053821289 9:41969776-41969798 CAGAAAAAAAAAAATTAGCCAGG - Intronic
1055127632 9:72737417-72737439 CAGAAAACAAACAAATGGTCAGG - Intronic
1055427541 9:76211685-76211707 CAAAAATAAAACAATTAGTCAGG + Intronic
1055492709 9:76822510-76822532 GAGAAAAAGAAGAATAGGTCGGG + Intronic
1055843325 9:80531706-80531728 CACAGAAAGAAAAAGTGGTCTGG - Intergenic
1056852337 9:90095173-90095195 CAGAAAGAGAACATCTGGTAGGG - Intergenic
1057168305 9:92945390-92945412 AAAAAAAAGAACAATGGGTCTGG + Intergenic
1057407596 9:94787670-94787692 CAGAAAAAGAATAACACGTCTGG - Intronic
1057535304 9:95896718-95896740 CAAAAAAGCAACAACTGGTCTGG - Intronic
1057777491 9:98022668-98022690 TAGAAAAAGAGCAGTTGGGCAGG - Intergenic
1058304843 9:103426945-103426967 TAGAAAAAGAACAAATGGGATGG + Intergenic
1058755126 9:108076720-108076742 CCAAAAAAGAACATTTGGTCAGG - Intergenic
1058862222 9:109127438-109127460 CACATAAAGAAAAATTAGTCTGG - Intergenic
1059193598 9:112349696-112349718 CAAAAATACAACAATTAGTCAGG + Intergenic
1060383911 9:123204761-123204783 CAGAAAAAAAAAAATTAGCCAGG + Intronic
1060643419 9:125258160-125258182 AAGAAAAAGAAAAATTAGCCAGG + Intergenic
1061081434 9:128373074-128373096 CAGAAAAAGGGCAATTGTGCTGG - Intronic
1061151511 9:128831010-128831032 AAGAAAAAAAAAAATTAGTCGGG - Intergenic
1061379560 9:130245910-130245932 AAAAAAAAAAAAAATTGGTCTGG + Intergenic
1061675415 9:132212854-132212876 CAGAGAAGAAACAAATGGTCAGG - Intronic
1061776177 9:132966196-132966218 AAGAAATAAAAAAATTGGTCAGG + Intronic
1203757035 Un_GL000218v1:141349-141371 CAAAAGAAGAAATATTGGTCAGG - Intergenic
1203716418 Un_KI270742v1:154024-154046 CAAAAGAAGAAATATTGGTCTGG - Intergenic
1203534796 Un_KI270743v1:24215-24237 CAAAAGAAGAAATATTGGTCTGG + Intergenic
1203536743 Un_KI270743v1:47289-47311 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1203650646 Un_KI270751v1:117579-117601 CAAAAGAAGAAATATTGGTCTGG - Intergenic
1185588674 X:1259365-1259387 CAAAAAAAAAAAAATTAGTCAGG + Intergenic
1185861016 X:3579398-3579420 TAGAAAAAGAACAATAGGCCAGG + Intergenic
1186540577 X:10396044-10396066 CAGAGAGAGAACAGTTGGGCGGG - Intergenic
1186986594 X:15021364-15021386 CACAATAACAACAATTAGTCAGG - Intergenic
1187050527 X:15691428-15691450 AAAAAAAAAAACAATTGGCCAGG + Intronic
1187148160 X:16656568-16656590 CACAAAAAGAAAAATTAGCCGGG - Intronic
1187323551 X:18264974-18264996 TAGAAAAACAACAATTTATCTGG - Intronic
1187795273 X:22997029-22997051 ATGAAAAAAAAAAATTGGTCAGG + Intergenic
1187882834 X:23862610-23862632 CACAAAAAAAAAAATTAGTCAGG + Intronic
1188600811 X:31961283-31961305 TAAAAACAGAAAAATTGGTCTGG + Intronic
1189426624 X:40907607-40907629 CAAAAAAAAAAAAATTGGCCAGG - Intergenic
1189468267 X:41294379-41294401 CAAAAAAAAAAAAATTAGTCGGG + Intergenic
1189596101 X:42567098-42567120 CAGAAAAAGAACAATGGAAGGGG - Intergenic
1190028359 X:46947312-46947334 CAGAAAAAGACCAAAAGGCCAGG - Intronic
1190756052 X:53403026-53403048 CAAAAAAAGAAAAATTAGCCGGG + Intronic
1192578841 X:72264207-72264229 CAAAAAAAAAAAAATTAGTCAGG - Intronic
1192885052 X:75328081-75328103 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1193195344 X:78625117-78625139 CAGAAAAAGAACACTAGATTTGG - Intergenic
1193425694 X:81338208-81338230 CAGAATAAGAACCACTGGCCTGG - Intergenic
1194102378 X:89721914-89721936 CAGAAAATGAACTATTATTCAGG - Intergenic
1195028903 X:100907354-100907376 AAGAAAAAGAAAAATCAGTCAGG - Intergenic
1195054433 X:101129524-101129546 AAGAAGAAGAAGAATTGGCCTGG - Intronic
1196270496 X:113704814-113704836 CAAAAAAAAAAAAATTGTTCTGG - Intergenic
1196472020 X:116039479-116039501 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1196812502 X:119639962-119639984 CAAAAAAAAAAAAATTAGTCAGG - Intronic
1196836746 X:119820618-119820640 CAAAAAAAAAAAAATTGGCCAGG - Intergenic
1198216873 X:134563570-134563592 CAGAGAAAGTGCAAGTGGTCTGG - Intergenic
1199516077 X:148676820-148676842 GAGAAAAAGAAAGATTGGTTGGG + Intronic
1200448205 Y:3290765-3290787 CAAAAAAACAAAAATTAGTCAGG + Intergenic
1200454965 Y:3379192-3379214 CAGAAAATGAACTATTATTCAGG - Intergenic
1200803972 Y:7413197-7413219 TAGAAAAAGAACAATGGCTCAGG - Intergenic
1200978901 Y:9243306-9243328 CAGAAGGAGAACAATTGATTTGG + Intergenic
1201018163 Y:9625333-9625355 CAGACACAGAAGAAGTGGTCAGG - Intergenic
1201168708 Y:11235865-11235887 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1201625962 Y:16014790-16014812 ATGAAAAAGAACACGTGGTCTGG - Intergenic
1201700605 Y:16877605-16877627 CAGAAACAGAACAACTGATTTGG + Intergenic
1201706728 Y:16946019-16946041 AAGAAAAAGAAAAATTAGCCAGG + Intergenic
1202087090 Y:21149677-21149699 AAAAAAAAAAAAAATTGGTCGGG - Intergenic