ID: 932112093

View in Genome Browser
Species Human (GRCh38)
Location 2:69011121-69011143
Sequence GCTTGAATGTGGAAAGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932112093 Original CRISPR GCTTGAATGTGGAAAGCGGG TGG (reversed) Intergenic
900079444 1:844641-844663 GCCTGAAAGTGGCAAGCGTGTGG - Intergenic
903025790 1:20429140-20429162 GCTCGAATGTGGACAGGAGGAGG - Intergenic
903203227 1:21760630-21760652 ACTTGAAACTGGAAGGCGGGAGG + Intronic
903443098 1:23402928-23402950 GCTGAAATGTGGAAAGAGGAAGG + Intronic
904224259 1:29001759-29001781 GCTTGATTGTGTAAAGGAGGAGG - Intronic
905846156 1:41234555-41234577 GCTTGAACGTGGGAGGCGGGAGG - Intronic
906636554 1:47414257-47414279 GCCTGAATGTGGAGAGTGAGTGG + Intergenic
906750646 1:48256230-48256252 ACTTGAGAGTGGAAAGTGGGAGG + Intergenic
906888857 1:49685054-49685076 TCTTGAAGGTGGAAGGTGGGAGG - Intronic
908807741 1:67948438-67948460 CCTTGAATGTGAAAAGTGGATGG - Intergenic
910148256 1:84108319-84108341 ACTTGAGGGTGGAAGGCGGGAGG + Intronic
911579533 1:99619054-99619076 GGTAGAATGTGGATAGTGGGAGG + Intergenic
912468966 1:109893603-109893625 GCTTGAATGTGGTGAAGGGGAGG + Intergenic
912675526 1:111676874-111676896 GCTTGAACATGGGAAGCGGAGGG - Intronic
912732625 1:112122615-112122637 GCTTGAGGGTGGAAGGTGGGAGG + Intergenic
914217766 1:145648885-145648907 ACTTGAATCTGGAAGGCGGAGGG - Intronic
914470325 1:147971557-147971579 ACTTGAATCTGGAAGGCGGAGGG - Intronic
918394977 1:184104274-184104296 ACTTGAAGGTGGAGAGGGGGAGG - Intergenic
922012033 1:221598534-221598556 GCTTAAATGTGGTAAGGTGGTGG - Intergenic
922207150 1:223458046-223458068 ACTTGAGTGTGGAGAGTGGGAGG - Intergenic
923544126 1:234911988-234912010 GCTTGTGTGTGGAAGGCGGAGGG + Intergenic
924702628 1:246469184-246469206 GAGTGATTGTGGAAAGCAGGTGG - Intronic
924949647 1:248870748-248870770 GGTGGAATGAGGAAAGAGGGTGG + Intergenic
1063732047 10:8708791-8708813 GCTTGAGGGTGGAGAGTGGGAGG + Intergenic
1064313227 10:14230778-14230800 GCTTGAAGGTGGAAGGTGGAAGG - Intronic
1064669976 10:17702923-17702945 GCTTGAATCTGGGAGGCGGAAGG + Intronic
1069386514 10:67887657-67887679 GCTTGAACCTGGAAGGCGGAGGG - Intronic
1078198517 11:9157478-9157500 GCTTGAGAGTGGAGAGTGGGAGG - Intronic
1078724389 11:13916541-13916563 GGGTGAATGTGGAATGTGGGGGG + Intergenic
1080785798 11:35473877-35473899 GGGTGAGTGAGGAAAGCGGGAGG + Intronic
1081060380 11:38467608-38467630 ACTTGAGTGTGGAGAGTGGGAGG + Intergenic
1082773201 11:57224890-57224912 ACTTGAATGTGGAATGGGGGTGG - Intergenic
1083495253 11:63046569-63046591 ACTTGAAGGTGGAGAGTGGGAGG + Intergenic
1087614797 11:100475469-100475491 GCTTGAGGGTGGAACGTGGGAGG - Intergenic
1087642610 11:100771679-100771701 GCTTGAACATGGGAAGCGGAGGG - Intronic
1087753519 11:102030837-102030859 GCTTGAACCTGGAAGGCGGAAGG - Intergenic
1089927406 11:122272865-122272887 ACTTGAAGGTGGAAGGAGGGTGG + Intergenic
1090310515 11:125732649-125732671 GGTTGAATGTGGAACAAGGGAGG + Intergenic
1091095875 11:132821737-132821759 GCTGGAAGATGGAAAGAGGGGGG - Intronic
1093428071 12:19051866-19051888 GCTTGAACCTGGGAGGCGGGAGG - Intergenic
1094446017 12:30531354-30531376 TCTTGGATTTGGAAAGGGGGTGG + Intergenic
1095458970 12:42421428-42421450 GCTTGAACCTGGGAAGCAGGAGG - Intronic
1098327140 12:69314995-69315017 ACTTGAGGGTGGAAAGTGGGAGG - Intergenic
1098562434 12:71889786-71889808 ACTTGAGGGTGGAAAGTGGGAGG - Intronic
1100251583 12:92830318-92830340 GCTTGAGGGTGGAAGGTGGGAGG - Intronic
1100572488 12:95856401-95856423 GCTTGAATCTGGGAAGCGGAGGG + Intergenic
1100602681 12:96125654-96125676 GTTTGAATGTGGCAGGTGGGGGG - Intergenic
1101928857 12:108995816-108995838 GCTTGAATCTGGGAGGGGGGAGG + Intronic
1102469455 12:113151397-113151419 GCTTGAACCTGGAAGGCGGGAGG + Intronic
1102537892 12:113594964-113594986 ACTTGAAGGTGGACAGTGGGAGG - Intergenic
1107783424 13:43929456-43929478 GCTTGTATTTGGAAAGCAGAAGG - Intergenic
1109991720 13:70067467-70067489 CCTTGTATGGGGAAAGCCGGTGG + Intronic
1114416136 14:22545940-22545962 GCTTTAAAGAGGAAAGGGGGTGG - Intergenic
1116558688 14:46347586-46347608 GCTTGAGGGTGGAGAGAGGGAGG + Intergenic
1116609740 14:47052939-47052961 GATTGAATATGGAAAGAGTGAGG - Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1122102747 14:99426506-99426528 GCCTGAATGTGGGGAGAGGGCGG + Intronic
1122974485 14:105165496-105165518 TCTTGAATGTGGAGAGGTGGTGG - Intronic
1124712769 15:32029644-32029666 GCTTGATTTTGGAAAGAGGAAGG - Intergenic
1125025027 15:35020948-35020970 GCTTGAACCTGGGAGGCGGGAGG + Intergenic
1126371953 15:47956645-47956667 ACTTGAGGGTGGAAAGTGGGAGG - Intergenic
1128276858 15:66361047-66361069 ACTTGAATCTGGGAGGCGGGAGG + Intronic
1128515793 15:68341048-68341070 GCTTGACTCTGTAAAGCGGTGGG - Intronic
1129438705 15:75563080-75563102 ACTTGAGTGTGGAGAGTGGGAGG - Intronic
1132358013 15:101187394-101187416 GCTTGAACCTGGGAAGCGGAGGG + Intronic
1132468179 16:87313-87335 GCTTGAATCTGGGAGGCGGGAGG - Intronic
1133305948 16:4809271-4809293 GCTTGAACCTGGGAGGCGGGAGG - Intronic
1135779033 16:25282772-25282794 GCTTACATGTGGAGATCGGGGGG - Intergenic
1136648374 16:31643389-31643411 ACTTGAATGTGGAAGGTGGGAGG - Intergenic
1138351701 16:56349424-56349446 GCTTGAGTGTGGACAGCCCGAGG + Intronic
1140974720 16:80048137-80048159 ACTGGAAGGTGGAAAGTGGGAGG + Intergenic
1141927654 16:87179613-87179635 GCGTGAGGCTGGAAAGCGGGAGG + Intronic
1142409193 16:89907711-89907733 GCTGGAAGGTGGGAGGCGGGAGG - Intronic
1142505288 17:359280-359302 GCTAGAAGGTTGAAAGCAGGGGG - Intronic
1142755532 17:2014393-2014415 CCTTGAATGGGGAGAGTGGGGGG - Intronic
1143710542 17:8731746-8731768 GCTTGAGGGTGGAGAGTGGGAGG + Intronic
1143999983 17:11044749-11044771 TCTTGAAGGTGGAAGGTGGGGGG - Intergenic
1144201230 17:12944172-12944194 GCTTGAGTGTGGGATGCAGGAGG + Exonic
1147400173 17:40176232-40176254 GCTTGAAAGGGGAAAGTGGCTGG - Intergenic
1148177211 17:45577244-45577266 GCTGGGATGTGGTGAGCGGGAGG - Intergenic
1150559679 17:66283762-66283784 GCTTGAACCTGGAAGGTGGGAGG - Intergenic
1150706956 17:67495528-67495550 GCTTGATGGTGGAGAGTGGGAGG - Intronic
1151422293 17:74006403-74006425 GCTTGAATGTGGACTCCGGGTGG - Intergenic
1152753489 17:82077413-82077435 GCGTGAGTGTGGACAGCAGGCGG - Intergenic
1153806175 18:8709920-8709942 GCTTGAATCTGGGAGGCGGAGGG - Intronic
1154183116 18:12154964-12154986 GCTTGAGAGTGGAAGGTGGGAGG + Intergenic
1155078183 18:22381530-22381552 TCTTGAATGTGAAAAGGGGAGGG - Intergenic
1155455467 18:26007618-26007640 GCTTGAATCTGGGAGGTGGGAGG - Intergenic
1155463942 18:26114861-26114883 GCTTGACTGTTGAAAGCTGGAGG + Intergenic
1155468874 18:26169760-26169782 GCTTGAATCTGGGAAGGCGGAGG + Intronic
1156427973 18:37036689-37036711 GTTTTCATGTGGAAAGAGGGTGG - Intronic
1156715381 18:40002717-40002739 ACTTGAAGGTGGAGAGCGGGAGG + Intergenic
1157713668 18:49867261-49867283 GCTTGGATGTGGGAAGTGAGTGG + Intronic
1160451831 18:78971693-78971715 GCTTGGATGTGGAAGGAGAGTGG - Intergenic
1162610473 19:11746345-11746367 GCTTGAACCTGGAAGGCGGAGGG - Intergenic
1162761430 19:12891017-12891039 CCTTGCCTGTGGAAATCGGGGGG - Exonic
1162844061 19:13378748-13378770 GCTTGAACCTGGGAGGCGGGGGG - Intronic
1163059438 19:14748125-14748147 GCTTGAGGGTGGAGAGTGGGAGG - Intronic
1164183404 19:22839554-22839576 GCTTGAACCTGGGAAGCAGGAGG - Intergenic
1164494413 19:28746290-28746312 GCTGGAATGGGGAAGGCAGGGGG - Intergenic
1164509287 19:28884411-28884433 GCTTGAGGGTGGAAGGTGGGAGG - Intergenic
1164805021 19:31109751-31109773 GCTTGCATGTGGACAGAGAGAGG - Intergenic
1165302455 19:34979372-34979394 ACTGGACTTTGGAAAGCGGGTGG + Intergenic
1166970658 19:46565120-46565142 GCATGAATGTGGAAGGCAGAAGG + Intronic
1167503323 19:49859140-49859162 GCTGGAAGGTGGACATCGGGGGG - Intronic
1167656553 19:50768139-50768161 GCTTGAATCTGGGAAGCTGGAGG - Intergenic
925017712 2:543997-544019 GCTTGAAGGTGGGAGGCTGGAGG + Intergenic
926385813 2:12334743-12334765 GCTTGAATGGTGAAATGGGGAGG + Intergenic
926705436 2:15834276-15834298 CCTTGAATGTGGGCAGCAGGTGG - Intergenic
928841630 2:35612376-35612398 GCTTGAACCTGGGAAGTGGGAGG + Intergenic
929468801 2:42170028-42170050 GCGTGTATGTGGAAAGGTGGTGG - Intronic
929598077 2:43188551-43188573 GCTTGAACCTGGGAGGCGGGAGG - Intergenic
930042778 2:47140967-47140989 GCTTGAATCTGGAAGGTGGAGGG - Intronic
930182591 2:48378287-48378309 GCTTGAAGGTGGAAAAAGGGAGG - Exonic
932112093 2:69011121-69011143 GCTTGAATGTGGAAAGCGGGTGG - Intergenic
932172987 2:69574286-69574308 GCTTGAATCTTGAATCCGGGAGG + Intronic
934764520 2:96873214-96873236 GCATGAAGGTGGAAAAGGGGAGG - Intergenic
934878609 2:97951792-97951814 TCTAAAAGGTGGAAAGCGGGTGG - Intronic
935326438 2:101941761-101941783 TCTGAAATGTGGAAAGAGGGTGG - Intergenic
935930525 2:108119563-108119585 GCTTGAATCTGAAAACCTGGTGG - Intergenic
936751715 2:115650396-115650418 GCTGGCATGGGGAAAGGGGGGGG + Intronic
939292029 2:140208158-140208180 ACTTGAAGGTGGAAGGTGGGAGG + Intergenic
939660881 2:144888024-144888046 GCTTGAATGTGAAGAGCGAGGGG - Intergenic
940065153 2:149619504-149619526 ACTTGAATGTGGAAAAATGGTGG + Intergenic
941067598 2:160920772-160920794 GCTCGAGAGTGGAAGGCGGGAGG + Intergenic
942164326 2:173227452-173227474 GCTTGAATTTGGCAAGACGGGGG - Intronic
945965320 2:216180541-216180563 GCTTGAACCTGGGAGGCGGGAGG + Intronic
946182890 2:217959699-217959721 GCTTGAGTGTGGACATTGGGTGG - Intronic
947541523 2:230983112-230983134 GCTTGAACCTGGAAGGCGGAGGG + Intergenic
947752422 2:232539939-232539961 GCTTGGAGGTGGAAAGAGCGGGG - Intronic
948428129 2:237901577-237901599 GCTAGAATGTGGCCAGCAGGAGG + Intronic
1168820375 20:768900-768922 GCTTGGATGTGGACAGCAGAGGG - Intergenic
1169177310 20:3528582-3528604 GCTTGAGGGTGGAGAGTGGGAGG + Intronic
1169369006 20:5014300-5014322 ACTGGAATGTGGAAAGTAGGAGG + Intergenic
1169384521 20:5136938-5136960 GCTTGAGGGTGGAGAGTGGGAGG - Intronic
1174285316 20:49468712-49468734 CCTTGAAGGTGGAAAGAGAGAGG + Intronic
1174352663 20:49979529-49979551 GAAGGAAAGTGGAAAGCGGGAGG + Intergenic
1174711414 20:52709590-52709612 ACTTGAAGGTGGAGAGTGGGAGG + Intergenic
1177635455 21:23781733-23781755 GCTTGAACCTGGGAAGCGGAAGG + Intergenic
1177790351 21:25716078-25716100 GCTTGAATCTGGGAGGCGGAGGG - Intronic
1177827984 21:26105632-26105654 GCTACAATGTGGAAAGTGGCAGG + Intronic
1178346708 21:31834961-31834983 GTTTGAGGGTGGAAAGTGGGAGG + Intergenic
1178357568 21:31921441-31921463 GCTTGAGTGGGGGAAGGGGGTGG + Intronic
1179903691 21:44408413-44408435 GCAGGAATGTGGAATGCGGCCGG - Intronic
1180064843 21:45407006-45407028 AATGGAATGTGGAAGGCGGGTGG + Intronic
1181449808 22:23012118-23012140 GCCTGAATGTGGAGAACTGGGGG + Intergenic
1184822622 22:46921234-46921256 GCCTGAGGGTGGAGAGCGGGAGG - Intronic
949125025 3:436811-436833 GCTTTAATGGGGAAAGACGGAGG + Intergenic
950796846 3:15517057-15517079 GCTTGAACCTGGAAGGCGGAGGG + Intronic
950848434 3:16038036-16038058 ACTTGAGGGTGGAAAGTGGGAGG - Intergenic
950974641 3:17227693-17227715 ACTTGAATGTGGAGGGTGGGAGG + Intronic
953265330 3:41381312-41381334 GCTTGAATGTGGATTCCGGAAGG - Intronic
954838286 3:53490407-53490429 GGTTGAATGTGGAAGGAAGGAGG + Intergenic
955755325 3:62219938-62219960 GCTTAAATCTGGAAAGGGGAGGG + Intronic
956615269 3:71164852-71164874 GCTGGAATGTAGGAAGAGGGGGG - Intronic
958014352 3:87920719-87920741 GCTTGAAGGTGGAGAGTGGGAGG + Intergenic
958927150 3:100171342-100171364 GCTTGAAAGGGGGAAGAGGGGGG - Intronic
959088888 3:101881297-101881319 GCTTTCATGTGGAAAGGGGTAGG - Intergenic
959128242 3:102317612-102317634 GCTTGAAAGTGGAGGGTGGGAGG - Intronic
960814933 3:121662650-121662672 GCTTGAAACTGGAAGGCGGAAGG + Intergenic
961643404 3:128379291-128379313 GCTTCAATGGCCAAAGCGGGAGG - Intronic
962033787 3:131629525-131629547 GCTTGAACCTGGGAAGCGGAGGG - Intronic
962271240 3:133979469-133979491 GCTTGAATGAGGTGAGCAGGAGG - Exonic
964346773 3:155761664-155761686 GCTTGAATCTGGGAAGGGAGAGG + Intergenic
966173771 3:177112918-177112940 GCTTGAATCTGAAAGGCGGAGGG + Intronic
966679586 3:182627347-182627369 GTTTGAATGTGGAAAACGTTAGG - Intergenic
966735261 3:183182175-183182197 GCCTGAACGTGGAAAGAGGAAGG + Intronic
967746814 3:193065533-193065555 CATTGAATGTGGAAAGTGAGAGG - Intergenic
968848981 4:3065321-3065343 GCTTGAACCTGGGAGGCGGGGGG - Intergenic
969358102 4:6643088-6643110 GCTTCAATCTGGAAGGAGGGTGG - Intergenic
970224337 4:13841806-13841828 ACTTGAAGGTGGAAAATGGGAGG + Intergenic
970589318 4:17545667-17545689 GCTTGAATGGGGAAAGTCAGGGG + Intergenic
973579731 4:52331368-52331390 CCTTGATTGTGGAAAGAGAGTGG + Intergenic
974198289 4:58605179-58605201 ACTTGAAGGTGGAAGGTGGGAGG - Intergenic
977850394 4:101820620-101820642 GCTTGAAGGTGGAGGGTGGGAGG - Intronic
979305148 4:119133894-119133916 GCTTGAATGTACAAAGGTGGTGG - Intergenic
980453817 4:133012562-133012584 GCTTGAACCTGGGAGGCGGGAGG + Intergenic
982631256 4:157832309-157832331 GCTTGAACCTGGGAAGCGGGGGG - Intergenic
983522076 4:168719725-168719747 GCTTGAGGGTGGAGAGCGGGAGG - Intronic
984984577 4:185315374-185315396 GCTTGAATCTGGGAGGCGGAGGG - Intronic
985059029 4:186057981-186058003 GACTGAAGGTGGATAGCGGGAGG - Intergenic
986094478 5:4541092-4541114 AATTGAATGTGGAAAGTGGGTGG - Intergenic
986473373 5:8097792-8097814 GCTTCTATGTGAAAAGTGGGTGG - Intergenic
988163567 5:27552385-27552407 CATTGAAAGTGGAAAGAGGGGGG - Intergenic
988348382 5:30069750-30069772 GCTGAAATGTGGAAAGAGAGAGG - Intergenic
991979599 5:72217576-72217598 GCTTGAATGTGTAGAACAGGTGG + Intergenic
992834654 5:80628124-80628146 GCTTGAATCTGGGAAGGCGGAGG + Exonic
993273930 5:85831844-85831866 GCTTGAGGGTGGAAGGTGGGAGG + Intergenic
993683751 5:90912532-90912554 ACTAGAATGTGGAAGGAGGGAGG - Intronic
995624645 5:114063140-114063162 GCTAGAGTGTGGAATGAGGGAGG - Intergenic
998647790 5:144082672-144082694 GCTTGAAGTTGGAGAGTGGGAGG + Intergenic
999538633 5:152547532-152547554 GCTTGAATGTGGGAGCCAGGCGG - Intergenic
1001818454 5:174691097-174691119 ACTTGAATCTGGGAAGCGGAGGG - Intergenic
1001937684 5:175717003-175717025 GGTGGAATCTGGGAAGCGGGTGG + Intergenic
1003230936 6:4253229-4253251 GGTTGAATGTTGAGAGAGGGTGG - Intergenic
1006344446 6:33468668-33468690 ACTTGAATGTGGAGGGTGGGAGG + Intergenic
1008019408 6:46558911-46558933 GCTTGAACCTGGGAAGCAGGGGG + Intronic
1009299625 6:61998682-61998704 GCATGAATTTGGAAAGCAGAAGG - Intronic
1010680397 6:78792466-78792488 ACTTGAGTGTGGACAGTGGGAGG + Intergenic
1015903143 6:138088093-138088115 GCTTGACTTTGGAAATTGGGTGG + Intergenic
1016950838 6:149578000-149578022 GCAGGAATGGGGAAAGAGGGTGG - Intronic
1021233030 7:18108702-18108724 GCTTGAATCTGGGAGGCAGGAGG - Intronic
1021854023 7:24835904-24835926 ACTGGAATGTGGAGAGTGGGTGG + Intronic
1022314812 7:29235879-29235901 GCTTGAAGGTGGAGGGTGGGAGG + Intronic
1022653274 7:32296459-32296481 GAATAAATGTGGAAAGGGGGAGG + Intronic
1024927271 7:54630464-54630486 GCTTGAGAGTGGAGAGAGGGAGG - Intergenic
1025022017 7:55487802-55487824 GATTGAATGTGGCAAGGGGGTGG - Intronic
1025860851 7:65326204-65326226 GCAGGAATGTGGAAATAGGGGGG - Intergenic
1026022917 7:66724440-66724462 GCTTGAACCTGGGAAGCGGTGGG - Intronic
1027776637 7:82473292-82473314 GCTTGAACCCGGGAAGCGGGGGG + Intergenic
1032164556 7:129535021-129535043 GCTTGAATCTGGGAGGCGGAGGG + Intergenic
1033003384 7:137532713-137532735 GGCTGAATTGGGAAAGCGGGAGG - Intronic
1034341994 7:150363373-150363395 GGATGACTGTGGAAAGCTGGAGG - Intergenic
1034918766 7:155061746-155061768 GCTTGAACCTGGGAAGCGGAGGG + Intergenic
1035320320 7:158024968-158024990 GCTTGATTGTGGGCAGTGGGTGG + Intronic
1035994885 8:4534583-4534605 ACTAGAATGGGGAAAGAGGGAGG - Intronic
1036506058 8:9357386-9357408 ACTTGAGTGTGGAGAGTGGGAGG + Intergenic
1036937114 8:13013864-13013886 GCTTGAACCTGGAAGGCGGAGGG + Intronic
1037782325 8:21878670-21878692 GCTTGAATCTGGGAGGCGGAGGG + Intergenic
1038777075 8:30540756-30540778 ACTTGAGTGTGGAAGCCGGGAGG + Intronic
1039514394 8:38119720-38119742 GCTTGAACCTGGGAGGCGGGTGG + Intronic
1039705515 8:40002695-40002717 GCTTGAACCTGGCAGGCGGGGGG + Intronic
1040075535 8:43225331-43225353 GCTTGAATCTAGGAGGCGGGAGG - Intergenic
1042110780 8:65379010-65379032 GCTTGAATCCGGGAGGCGGGAGG + Intergenic
1042142213 8:65690444-65690466 GCTTGAACTTGGGAGGCGGGAGG + Intronic
1042703987 8:71647392-71647414 GCCTGAGGGTGGAAAGTGGGAGG + Intergenic
1043265651 8:78265041-78265063 GCTTGAACCTGGAAGGCGGAGGG + Intergenic
1044666320 8:94638341-94638363 GCTTGAACCTGGGAGGCGGGGGG - Intergenic
1048268599 8:133009816-133009838 GCTGGAAGTTTGAAAGCGGGGGG - Intronic
1050070778 9:1811064-1811086 ACTTGAGGGTGGAGAGCGGGAGG + Intergenic
1050543311 9:6688373-6688395 GCTTGAAGCTGGGAGGCGGGAGG + Intergenic
1053144792 9:35705083-35705105 GCTTGAATGTGGGAATCAGAGGG + Intronic
1055960694 9:81817687-81817709 GCTTGAAACTGGGAGGCGGGGGG + Intergenic
1058343679 9:103930627-103930649 GGTTGCATGTAGAAAGAGGGAGG + Intergenic
1058855240 9:109055715-109055737 GCTTGAATCTGGGAGGCGGAGGG - Intronic
1061092844 9:128436328-128436350 GCTTGAATCCGGGACGCGGGAGG - Intronic
1062107339 9:134763143-134763165 GCTTGCATGTGTGAGGCGGGCGG + Intronic
1203691328 Un_GL000214v1:45828-45850 GCTTGAATCTGGGAGGCAGGGGG - Intergenic
1203644967 Un_KI270751v1:58363-58385 GCTTGAATCTGGGAGGCAGGGGG + Intergenic
1187211895 X:17240219-17240241 GCTTGAACCTGGGAGGCGGGAGG + Intergenic
1188304160 X:28542039-28542061 GCTTTCAGGTAGAAAGCGGGAGG - Intergenic
1189444537 X:41068241-41068263 GCTTGAAGGTGGACAGAGGGAGG - Intergenic
1190501960 X:51088060-51088082 GCTTGAACCCGGGAAGCGGGAGG - Intergenic
1191744590 X:64472597-64472619 ACTTGAAGGTGGAAGGTGGGAGG - Intergenic
1193674349 X:84431015-84431037 ACTTGAAGGTGGAAGGTGGGAGG - Intronic
1194851061 X:98869828-98869850 ACTTGAGTGTGGAGAGCGGGAGG - Intergenic
1195517376 X:105792637-105792659 GCTTGAACCTGGGAGGCGGGAGG + Intergenic
1195928794 X:110052831-110052853 GCTTGAACCTGGAAGGCGGAAGG - Intronic
1199105405 X:143860530-143860552 ACTTGAGTGGGGAAAGTGGGAGG - Intergenic
1202594927 Y:26528482-26528504 GCTTGAACCTGGGAAGCGGAGGG - Intergenic