ID: 932113001

View in Genome Browser
Species Human (GRCh38)
Location 2:69018351-69018373
Sequence ACACCTGGATGATGCCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 135}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932112992_932113001 3 Left 932112992 2:69018325-69018347 CCCCCAGAGTTCCAACCACAGCA 0: 1
1: 0
2: 1
3: 25
4: 233
Right 932113001 2:69018351-69018373 ACACCTGGATGATGCCCTGCTGG 0: 1
1: 0
2: 2
3: 13
4: 135
932112996_932113001 -8 Left 932112996 2:69018336-69018358 CCAACCACAGCACCCACACCTGG 0: 1
1: 0
2: 2
3: 46
4: 613
Right 932113001 2:69018351-69018373 ACACCTGGATGATGCCCTGCTGG 0: 1
1: 0
2: 2
3: 13
4: 135
932112994_932113001 1 Left 932112994 2:69018327-69018349 CCCAGAGTTCCAACCACAGCACC 0: 1
1: 0
2: 1
3: 21
4: 194
Right 932113001 2:69018351-69018373 ACACCTGGATGATGCCCTGCTGG 0: 1
1: 0
2: 2
3: 13
4: 135
932112991_932113001 8 Left 932112991 2:69018320-69018342 CCACTCCCCCAGAGTTCCAACCA 0: 1
1: 1
2: 1
3: 10
4: 281
Right 932113001 2:69018351-69018373 ACACCTGGATGATGCCCTGCTGG 0: 1
1: 0
2: 2
3: 13
4: 135
932112993_932113001 2 Left 932112993 2:69018326-69018348 CCCCAGAGTTCCAACCACAGCAC 0: 1
1: 0
2: 2
3: 20
4: 282
Right 932113001 2:69018351-69018373 ACACCTGGATGATGCCCTGCTGG 0: 1
1: 0
2: 2
3: 13
4: 135
932112995_932113001 0 Left 932112995 2:69018328-69018350 CCAGAGTTCCAACCACAGCACCC 0: 1
1: 0
2: 2
3: 29
4: 284
Right 932113001 2:69018351-69018373 ACACCTGGATGATGCCCTGCTGG 0: 1
1: 0
2: 2
3: 13
4: 135
932112990_932113001 16 Left 932112990 2:69018312-69018334 CCATGTTGCCACTCCCCCAGAGT 0: 1
1: 0
2: 0
3: 15
4: 156
Right 932113001 2:69018351-69018373 ACACCTGGATGATGCCCTGCTGG 0: 1
1: 0
2: 2
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932113001 Original CRISPR ACACCTGGATGATGCCCTGC TGG Intronic