ID: 932113727

View in Genome Browser
Species Human (GRCh38)
Location 2:69025435-69025457
Sequence CTGCATATCATTAAGCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 681
Summary {0: 1, 1: 0, 2: 1, 3: 62, 4: 617}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932113727_932113733 18 Left 932113727 2:69025435-69025457 CCCTGATGCTTAATGATATGCAG 0: 1
1: 0
2: 1
3: 62
4: 617
Right 932113733 2:69025476-69025498 TGTAGAGACCTCCTGGAAGATGG 0: 1
1: 0
2: 1
3: 20
4: 163
932113727_932113731 11 Left 932113727 2:69025435-69025457 CCCTGATGCTTAATGATATGCAG 0: 1
1: 0
2: 1
3: 62
4: 617
Right 932113731 2:69025469-69025491 AAATACCTGTAGAGACCTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932113727 Original CRISPR CTGCATATCATTAAGCATCA GGG (reversed) Intronic
900721739 1:4180567-4180589 CTGCACACCATTAGTCATCAGGG - Intergenic
902424820 1:16311625-16311647 CTCCATATCATTTGTCATCAGGG + Intronic
902967511 1:20018907-20018929 CTCAATATCACTAATCATCAGGG - Intergenic
905406739 1:37738411-37738433 CTTAATATCATTAATCATCAGGG + Intronic
906809866 1:48815137-48815159 CTGAATGTCATTAATCATTAAGG - Intronic
906974524 1:50555510-50555532 CTCAATATCACTAATCATCAGGG + Intronic
907178230 1:52545583-52545605 CTGAATATCACTAATCATTAGGG + Intronic
908102229 1:60803401-60803423 CTCAATATCACTAATCATCAGGG - Intergenic
908105755 1:60840236-60840258 CTCAATATCATTAATCATTAGGG + Intergenic
909680045 1:78281607-78281629 CTCAACATCATTAATCATCAGGG + Intergenic
910419468 1:87042063-87042085 CTGGACATCACTAACCATCAGGG - Intronic
911986612 1:104634165-104634187 CTCAATATCTTTAAACATCATGG - Intergenic
912219420 1:107655851-107655873 CTCAATATCAATAACCATCAGGG + Intronic
912275479 1:108253813-108253835 CTCAATATCACTAATCATCAGGG - Intergenic
912292745 1:108440535-108440557 CTCAATATCACTAATCATCAGGG + Intronic
913578516 1:120201872-120201894 CTCAATATCATTAATCATTAGGG - Intergenic
913629656 1:120696479-120696501 CTCAATATCATTAATCATTAGGG + Intergenic
914560442 1:148813312-148813334 CTCAATATCATTAATCATTAGGG - Intronic
914612391 1:149316906-149316928 CTCAATATCATTAATCATTAGGG + Intergenic
914891575 1:151628722-151628744 CTCAATATCATTCATCATCAGGG - Intronic
915756940 1:158270898-158270920 CTGAACATCACTAATCATCAGGG + Intergenic
915858343 1:159414819-159414841 CTTAATATCACTAATCATCAGGG - Intergenic
916323122 1:163527998-163528020 CTGAACATCACTAATCATCAGGG + Intergenic
917378459 1:174377606-174377628 CTCAATATCATTAACCATCAGGG + Intronic
917547066 1:175981888-175981910 CTCAATATCATTAATCATCAGGG + Intronic
917832236 1:178904091-178904113 CTCCATATCACTAATGATCAGGG - Intronic
917946619 1:179979304-179979326 CTCAACATCACTAAGCATCAGGG - Intronic
917992134 1:180391554-180391576 CTCAATATCATTAACCATCAAGG + Intronic
917992537 1:180396692-180396714 CTCCATATCATTAGTCATTAGGG + Intronic
918021357 1:180695133-180695155 CTCAATATCACTAATCATCAGGG - Intronic
918030852 1:180808697-180808719 CTCAATATCATTAGGCATTATGG + Intronic
918402913 1:184181550-184181572 CTCAATATCATTAGCCATCAGGG + Intergenic
918721986 1:187864438-187864460 CTGCATAATATTAATCATTAAGG + Intergenic
918735655 1:188059516-188059538 CTCAATATCACTAAGCATCAGGG - Intergenic
918911045 1:190570016-190570038 CTCAACATCATTAAGTATCAAGG - Intergenic
918953422 1:191172160-191172182 CTCAATATTATTAATCATCAAGG + Intergenic
919144731 1:193619753-193619775 CTCAATATCACTAATCATCAGGG + Intergenic
919936807 1:202256951-202256973 CTTAACATCATTAATCATCAGGG - Intronic
920220458 1:204395559-204395581 CTCCATATCATTAAACACCAAGG + Intergenic
920426088 1:205876718-205876740 CTCAACATCACTAAGCATCAGGG - Intergenic
920602375 1:207341034-207341056 CTGCTCATCACTAATCATCATGG - Intronic
922329412 1:224560969-224560991 CTGAATATCATTAATCACGAGGG - Intronic
922822937 1:228496656-228496678 CTCAACATCATTAATCATCAGGG - Intergenic
923421517 1:233820611-233820633 CTCAATATCACTAACCATCAAGG - Intergenic
923669074 1:236024747-236024769 GTCCATATCTTTAAGCCTCAGGG - Intronic
924393178 1:243586127-243586149 CTGCACATCACTAATCTTCAGGG + Intronic
924849067 1:247806160-247806182 CTAAACATCATTAATCATCAGGG - Intergenic
1062802923 10:393449-393471 CTCCACATCACTAATCATCAGGG + Intronic
1063940653 10:11125196-11125218 GTGCAGATCATTAAACAGCAGGG + Intronic
1064143489 10:12809223-12809245 CTCAATATCACTAATCATCAGGG - Intronic
1064508770 10:16065708-16065730 CTCAACATCATTAATCATCATGG - Intergenic
1064631630 10:17319976-17319998 GTGCATATCATTAATTATGATGG - Exonic
1064668885 10:17687597-17687619 CCCCAGATAATTAAGCATCATGG + Intronic
1064893009 10:20200778-20200800 CTCAACATCATTAATCATCAAGG + Intronic
1064950899 10:20849056-20849078 ATGCCTAGCATGAAGCATCAAGG + Intronic
1065078900 10:22108454-22108476 CTCAATATCATTAATCATCAGGG - Intergenic
1066279758 10:33904650-33904672 CTGAACATCATTAATCATAAAGG - Intergenic
1066410263 10:35161676-35161698 CTCGACATCATTAATCATCAGGG + Intronic
1067413555 10:46086071-46086093 CTCCATATCACTAATCATTAAGG - Intergenic
1067790653 10:49284916-49284938 CTCCACATCACTAATCATCAGGG + Intergenic
1068023305 10:51611363-51611385 CTCAACATCATTAATCATCAGGG - Intronic
1068026619 10:51653448-51653470 CTAAATATCATTAATCATCAGGG - Intronic
1068695259 10:59961438-59961460 CTAAATATCATTAATCATTAGGG - Intergenic
1068925949 10:62538600-62538622 CTCAATATCACTAATCATCAGGG + Intronic
1069130659 10:64698018-64698040 CTCAATATCACTAATCATCAGGG + Intergenic
1069537077 10:69261967-69261989 CTGAATCTAATTAAGCATCTGGG - Intronic
1069803232 10:71095789-71095811 CTCAACATCATTAATCATCAGGG - Intergenic
1070397653 10:76025439-76025461 CAGCGTATCAGTAAGCAGCATGG - Intronic
1071024522 10:81096798-81096820 TTCCATATCACTAATCATCAGGG - Intergenic
1071445097 10:85738289-85738311 CTCCATATCATGAGTCATCAGGG + Intronic
1071880554 10:89892417-89892439 CTCCACATCACTAATCATCAGGG - Intergenic
1072347900 10:94526971-94526993 CTCAACATAATTAAGCATCAGGG - Intronic
1072574602 10:96688488-96688510 GTGCATATTTTTAAACATCATGG - Intronic
1073387697 10:103140771-103140793 CTTAACATCATTAATCATCAGGG - Intronic
1074033197 10:109709911-109709933 CTGAACATCACTAATCATCAGGG + Intergenic
1076095058 10:127726668-127726690 CTCAATATCATTAATCATCAGGG + Intergenic
1077656111 11:4020538-4020560 CTCAATATCACTAATCATCAGGG - Intronic
1077839445 11:5959397-5959419 CTTAATATCAGTAATCATCAGGG - Intergenic
1078769218 11:14331942-14331964 CTGAATATCATTAGTCGTCAAGG + Intronic
1078982058 11:16547014-16547036 CTCAATATCACTAATCATCAAGG + Intronic
1079511797 11:21219219-21219241 CTCAACATCATTAATCATCAAGG - Intronic
1079791234 11:24742440-24742462 CTCAATATCATTAATGATCAGGG - Intronic
1079854979 11:25591503-25591525 CTGAATATCACTAATGATCAGGG - Intergenic
1080077268 11:28165415-28165437 CTCTATATCATTAATCATCAGGG - Intronic
1081422396 11:42885161-42885183 CTTAATATCATTAAGCATTAGGG + Intergenic
1081515106 11:43821099-43821121 CTGCTTATGATTAAACATCATGG - Intronic
1081516880 11:43841116-43841138 CTCAATATCACTAATCATCAGGG - Intronic
1082111443 11:48280253-48280275 CTCAATATCATTAATTATCAGGG - Intergenic
1082901568 11:58259060-58259082 CTCAACATCATTAATCATCAGGG - Intergenic
1083495195 11:63045950-63045972 CTCAATATCACTAATCATCAGGG + Intergenic
1084187185 11:67480114-67480136 CTGCATACAATTAAGTATGATGG - Intergenic
1085538265 11:77240825-77240847 CTCAATATCACTAATCATCAGGG + Intronic
1085766008 11:79282068-79282090 CTGAATATCATTCATCATTAGGG + Intronic
1086182290 11:83967473-83967495 CTTAATATCACTAATCATCAAGG - Intronic
1086357675 11:86021415-86021437 CTCAATATCATTAGCCATCAGGG + Intronic
1086617021 11:88833385-88833407 CTCCACATCAATAAGCACCAGGG + Intronic
1087238086 11:95742765-95742787 CTGAACATCACTAATCATCAGGG - Intergenic
1087258316 11:95981512-95981534 CTACGTATCCTTAAGCAGCAGGG - Intronic
1087317503 11:96620857-96620879 CTCAATATCATTAACTATCAGGG - Intergenic
1087443126 11:98209928-98209950 CTCAACATCATTAATCATCAGGG - Intergenic
1088132774 11:106514260-106514282 CTTGACATCATTAATCATCAGGG + Intergenic
1089637039 11:119821493-119821515 CTGCATGTCATTGAGGATCTTGG + Intergenic
1089677751 11:120101401-120101423 CTGCACATCATCAGGCATCAGGG - Intergenic
1090554025 11:127854675-127854697 CTGCTCATCATCAAGCATTAAGG - Intergenic
1091033713 11:132214321-132214343 CTGCAGAACATTTATCATCAGGG + Intronic
1092439776 12:8489674-8489696 CTGAACATCACTAATCATCAGGG + Intergenic
1092625711 12:10326045-10326067 CTCAATATCACTAATCATCAGGG - Intergenic
1093210311 12:16300415-16300437 CTGTAGGTCATTAAGCAACATGG - Intergenic
1093517247 12:20003257-20003279 CTCAATATTACTAAGCATCATGG - Intergenic
1093597884 12:20983373-20983395 CTCAACATCATTAATCATCAGGG - Intergenic
1093744743 12:22727493-22727515 CTTCATATCATTATTCATTAGGG + Intergenic
1094210052 12:27879646-27879668 CTCAATATCACTAATCATCAGGG - Intergenic
1094747787 12:33365913-33365935 CTCCATCTCATTACGAATCAAGG - Intergenic
1094759171 12:33509997-33510019 CTCAATATAATTAATCATCAGGG + Intergenic
1095042672 12:37460662-37460684 CTCAACATCATTAATCATCAGGG - Intergenic
1095286903 12:40423453-40423475 CTCAACATCATTAATCATCAGGG - Intronic
1096026651 12:48370408-48370430 CTCAACATCACTAAGCATCACGG + Intergenic
1096666244 12:53167632-53167654 CTCAATATCATTAGTCATCAGGG + Intronic
1097600249 12:61682733-61682755 CTCAATATCACTAATCATCAGGG - Intergenic
1098129442 12:67333637-67333659 CTCAACATCATTAATCATCAGGG - Intergenic
1098511920 12:71325919-71325941 CTCAACATCATTAAGCATCAAGG + Intronic
1098924186 12:76330893-76330915 CTGCACATCACTAATCATCAAGG + Intergenic
1099192959 12:79579456-79579478 CTGAACATCACTAATCATCAGGG + Intronic
1099419033 12:82429669-82429691 CTGAACATCACTAATCATCAGGG - Intronic
1099459752 12:82907762-82907784 TAGCATATGATTAAGCATGAAGG + Intronic
1099587564 12:84540049-84540071 CTCAATATCACTAATCATCAGGG - Intergenic
1099793911 12:87371802-87371824 CTCCACATCATTAATCATCAGGG - Intergenic
1100400962 12:94229144-94229166 CTCAACATCATTAATCATCAAGG - Intronic
1101106917 12:101449494-101449516 CTGAATATCACTAATCATCAGGG - Intergenic
1101585861 12:106084851-106084873 CTGAACATCATTCAGCATAAAGG + Intronic
1101938119 12:109075724-109075746 CTCAATATCACTAATCATCAGGG - Intronic
1102395943 12:112585900-112585922 CTGCATATCAACAAGCACCCTGG - Intronic
1105315359 13:19255026-19255048 CTCAACATCATTAATCATCAAGG + Intergenic
1105334110 13:19448568-19448590 CTAAACATCATTAATCATCAGGG + Intronic
1105922755 13:24981141-24981163 CTAAACATCATTAATCATCAGGG + Intergenic
1106327523 13:28708385-28708407 CTGGATATCATTAGCCATCAGGG - Intronic
1107185053 13:37508095-37508117 CTCGATATCATTAATGATCAGGG + Intergenic
1107488252 13:40853136-40853158 CTAAACATCATTAATCATCAGGG + Intergenic
1107590897 13:41903780-41903802 CTGCATGGCTTTAAGCAGCAAGG + Intronic
1107843307 13:44482658-44482680 CTGCATATCATTTAGAGTAAAGG - Intronic
1108534303 13:51357680-51357702 CTGCATAACATCTAGTATCAAGG - Intronic
1108553977 13:51574895-51574917 CTCAATATCATTAGCCATCAAGG - Intergenic
1109002088 13:56818220-56818242 CTCAATATCACTAATCATCAGGG + Intergenic
1109106864 13:58263862-58263884 CTGAATATCACTAATCATCAGGG + Intergenic
1109760980 13:66828534-66828556 CTGCATATCATAAATCATCCTGG + Intronic
1110329418 13:74254090-74254112 ATGCATATAATTATGCATGAAGG - Intergenic
1110654279 13:77978289-77978311 CTCAATATCATTAATCACCAGGG - Intergenic
1110723622 13:78794192-78794214 CTCCACATCATTAATCATTAGGG - Intergenic
1110965894 13:81696807-81696829 CTCCACATCATTGATCATCAAGG + Intergenic
1111010895 13:82313281-82313303 CTTTACATCATTAATCATCAGGG + Intergenic
1111128429 13:83942408-83942430 CTGAATGTCATTATGTATCAGGG + Intergenic
1111162190 13:84409509-84409531 GTGCATATCTTTAAGTTTCATGG - Intergenic
1111424147 13:88057681-88057703 CTCGATATCATTAATCATCAGGG - Intergenic
1111572005 13:90101773-90101795 CTCAACATCATTAATCATCAGGG - Intergenic
1113364059 13:109660140-109660162 CTCCACATCATTAATCATCAAGG + Intergenic
1114335035 14:21680263-21680285 CTGCATTTCATGACTCATCATGG + Intergenic
1114852534 14:26398609-26398631 CTTAATATCATTAGTCATCAGGG - Intergenic
1114967608 14:27982669-27982691 CTGCATATAATAAAGCAGTATGG - Intergenic
1115041431 14:28934087-28934109 CTCAATATCATTAGTCATCAGGG - Intergenic
1115115304 14:29874230-29874252 CTCAATATCACTAAGCATCAGGG + Intronic
1115131678 14:30060506-30060528 CTCAATATCACTAACCATCATGG - Intronic
1115691586 14:35849674-35849696 CTCAATATCATTAATCATCAGGG - Intronic
1115942563 14:38625942-38625964 CTTCACATCACTAATCATCAGGG + Intergenic
1116284188 14:42950712-42950734 CTGCATATCACGAATCATCAGGG - Intergenic
1116310254 14:43316520-43316542 CTGCATTTCATGACTCATCATGG + Intergenic
1116923805 14:50611672-50611694 CTTAATTTCATTAATCATCAGGG + Intronic
1117226118 14:53661171-53661193 CTCCACATCATAAATCATCAGGG - Intergenic
1117614757 14:57522259-57522281 CTGAACATCATTAATTATCAGGG - Intergenic
1117723949 14:58653992-58654014 ATGCTCATCATTAGGCATCAGGG - Intergenic
1117734405 14:58754535-58754557 CTGGATTTAATTAAGAATCATGG - Intergenic
1117937979 14:60928580-60928602 CTCAATATCATTAACCATGAGGG - Intronic
1118250415 14:64154884-64154906 TTCCATGTCATTAACCATCAAGG + Intronic
1118435662 14:65768787-65768809 CTCAATATCATTAATCATTAGGG - Intergenic
1118519850 14:66570853-66570875 CTCCACATCACTAATCATCAGGG - Intronic
1120517204 14:85484922-85484944 CTCAATATCACTAATCATCAGGG - Intergenic
1120537215 14:85711838-85711860 CTGCTTTCCATTAGGCATCAAGG - Intergenic
1120832588 14:89011014-89011036 CTCCACATCATTAGTCATCAGGG + Intergenic
1120972931 14:90223964-90223986 CTGAACATTATTAATCATCAGGG + Intergenic
1121629892 14:95414256-95414278 CTTTATATCTTTAAGCCTCAGGG + Intronic
1121903756 14:97720776-97720798 CTAAACATCATTAATCATCAGGG - Intergenic
1122944523 14:105000658-105000680 CTCCATATCAGTAATCATCAGGG + Intronic
1202941207 14_KI270725v1_random:148296-148318 CTCAACATCATTAATCATCAGGG - Intergenic
1123784759 15:23659468-23659490 CTTGACATCATTAACCATCAGGG + Intergenic
1123802574 15:23836665-23836687 CTGAATATCAATAATAATCAGGG - Intergenic
1125335715 15:38624345-38624367 CTGCATATAATAAACCATCAGGG + Intergenic
1125798299 15:42421076-42421098 CTGCATCAGATTAAGCCTCACGG + Exonic
1125867961 15:43071801-43071823 CTCCATATCATAAGCCATCAGGG + Intronic
1126177335 15:45748918-45748940 CTCAATATCATTAATCATAAAGG - Intergenic
1126819682 15:52489969-52489991 CTGAACATCATTAATCATTAGGG + Intronic
1126820627 15:52500251-52500273 CTGAACATCATTAATCATTAGGG - Intronic
1127714496 15:61636189-61636211 CTCAATATCACTAATCATCAGGG + Intergenic
1128316663 15:66663935-66663957 CTCAATATCATTAATCATTAGGG - Intronic
1128860404 15:71065963-71065985 ATAGGTATCATTAAGCATCATGG + Intergenic
1129024324 15:72554991-72555013 CTCAGTATCATTCAGCATCATGG - Intronic
1129025598 15:72570711-72570733 CTGCATATCATTAGACATTGTGG + Intronic
1129075091 15:72987858-72987880 CTCAATATCACTAACCATCAGGG + Intergenic
1129774524 15:78227456-78227478 CTCAATATCATTGATCATCAGGG + Intronic
1131206263 15:90450687-90450709 CTCAACATCATTAATCATCAGGG - Intronic
1131318589 15:91364670-91364692 TTCCATATCAATAAGCATCAAGG + Intergenic
1131611863 15:93973460-93973482 CTGCACATCATTGAGCAAGAGGG + Intergenic
1131631338 15:94179792-94179814 CTTAATATCACTAATCATCAGGG + Intergenic
1132050319 15:98602282-98602304 CTCCACATCATTAGCCATCAGGG + Intergenic
1132281781 15:100623488-100623510 CTCAACATCATTAATCATCAGGG + Intronic
1133578477 16:7118327-7118349 ATGCTTATCACTAATCATCAGGG - Intronic
1133920060 16:10144400-10144422 CTCAACATCATTAATCATCAGGG - Intronic
1134432917 16:14228039-14228061 CTGGATATCACTAATCATTAAGG + Intronic
1135326693 16:21530658-21530680 CTCCACATCATTAATCATTAGGG + Intergenic
1135565700 16:23509900-23509922 CTGCGTCTCCTTAAGCCTCAAGG + Intronic
1136017463 16:27411362-27411384 CTCAATATCACTAATCATCAGGG - Intronic
1136336950 16:29616073-29616095 CTCCACATCATTAATCATTAGGG + Intergenic
1136658118 16:31725716-31725738 CTGAATATAATTAATCATCAGGG - Intronic
1139173518 16:64660131-64660153 ATGCACATCACTAATCATCAGGG - Intergenic
1139391294 16:66607561-66607583 ACGCATATCATTAAGGTTCAAGG + Intronic
1140659579 16:77174933-77174955 CTCAATATCACTAATCATCAGGG - Intergenic
1141166883 16:81666904-81666926 GTGCCACTCATTAAGCATCAGGG - Intronic
1142554462 17:764138-764160 CTCAATATCATTAGTCATCAGGG + Intronic
1142773470 17:2116969-2116991 CTCAATATCATTACTCATCAGGG + Intronic
1144254331 17:13451360-13451382 CTCAATATCATTAATTATCAGGG + Intergenic
1144276831 17:13678192-13678214 CTCAATATCATTAATTATCAGGG + Intergenic
1145195068 17:20885516-20885538 CTGCAAATCACTAAAGATCAAGG + Intronic
1145303961 17:21660870-21660892 CTACATATTATTAGGCATTATGG - Intergenic
1146582760 17:34053763-34053785 CTGCATATGATTAAGCAGGTGGG - Intronic
1147751348 17:42736063-42736085 CTCCATATCATTAGTCATTAGGG + Intronic
1148130771 17:45261597-45261619 CTGCAAAGCCTCAAGCATCAAGG + Intronic
1150039265 17:61841449-61841471 CTGAACATCACTAATCATCAGGG + Intronic
1150457091 17:65314920-65314942 ATGCATATCACTAATTATCAGGG + Intergenic
1152384576 17:79963819-79963841 CTCAATATCATTAATCATCGGGG - Intronic
1153148717 18:2064842-2064864 CTCAACATCATTAATCATCAAGG + Intergenic
1153410319 18:4785061-4785083 CTCAACATCATTAATCATCAGGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153532580 18:6063593-6063615 CTCAATATCACTAATCATCAGGG - Intronic
1155127426 18:22892178-22892200 CTCCACATCATTAGCCATCAGGG + Intronic
1156738114 18:40288343-40288365 CTGCCTAACATTACACATCAAGG + Intergenic
1156960342 18:43021285-43021307 CTCAATATAATTAATCATCAGGG + Intronic
1157095890 18:44685098-44685120 CTGCTGATCATTAACCATCATGG - Intronic
1157169989 18:45394590-45394612 CTCCATATCACTAATCATCAGGG - Intronic
1157503708 18:48210069-48210091 CTGAATATCATTAGCCACCAGGG + Intronic
1157588811 18:48822900-48822922 CTCAATGTCATTAATCATCAGGG - Intronic
1158094170 18:53752013-53752035 CTCAATATCATTAGTCATCAGGG + Intergenic
1158117013 18:54006449-54006471 ATGCACATCCATAAGCATCATGG + Intergenic
1159398665 18:67900664-67900686 CTCCACATCACTATGCATCAGGG + Intergenic
1160084356 18:75761103-75761125 CTGAACATCATTCATCATCAGGG - Intergenic
1161921400 19:7268857-7268879 CTGGATATCTTGAAGCATGATGG - Intronic
1163086962 19:14988539-14988561 CTGAATATAATTAATCATCAGGG + Intronic
1163098346 19:15077666-15077688 ATGCACATCACTAATCATCAGGG + Intergenic
1163332387 19:16648677-16648699 TTCAATATCATTAACCATCAGGG + Intronic
1164437757 19:28246562-28246584 CCCAATATCATTAACCATCAGGG - Intergenic
1164546387 19:29167875-29167897 CTCAATATTATTAATCATCAGGG + Intergenic
1164846129 19:31434036-31434058 CTGTATATCTCTAAGCATCCTGG + Intergenic
1165285277 19:34837141-34837163 CTCAATATTATTAATCATCAGGG - Intergenic
1165375097 19:35436297-35436319 CTTCATATCATCAAGTAGCAAGG + Intergenic
1165548066 19:36559032-36559054 CTCAATATCACTAAACATCAGGG + Intronic
1168453228 19:56482590-56482612 CTCTATATCACTAAGCATCAAGG - Intergenic
925477675 2:4235938-4235960 GTGCTTATCATTATGCATGAAGG + Intergenic
927296297 2:21457413-21457435 CTCAATGTCATTAATCATCAGGG - Intergenic
927410648 2:22821543-22821565 CTGAATGTCATTAGTCATCAGGG + Intergenic
927619582 2:24638733-24638755 CTCAACATCATTAATCATCAGGG - Intronic
928474534 2:31613415-31613437 CTCAATATCATTAGTCATCAGGG + Intergenic
928704651 2:33935084-33935106 CTCAATATCATTAATCACCAGGG - Intergenic
928801182 2:35094737-35094759 CTCAATATCACTAATCATCAAGG - Intergenic
928851423 2:35751947-35751969 CTCAATATCATTAGACATCAGGG + Intergenic
928974844 2:37074794-37074816 ATGCTTATCATTAGTCATCACGG + Intronic
930134863 2:47891857-47891879 CTCAACATCATTAATCATCAGGG - Intronic
930413498 2:51058270-51058292 ATTAATATCATTAATCATCAAGG + Intergenic
930579890 2:53197826-53197848 CTCAATATCATTGATCATCAGGG + Intergenic
930825142 2:55689338-55689360 CTCAATATCATTAACTATCAGGG + Intronic
931186385 2:59955746-59955768 CTCAACATCATTAATCATCAGGG + Intergenic
931216995 2:60254779-60254801 CTCAATATCACTAATCATCAGGG - Intergenic
931831493 2:66056454-66056476 CTCAATATCATTAACCATCAGGG - Intergenic
931896155 2:66732295-66732317 CTCAACATCATTAATCATCAGGG + Intergenic
932110828 2:68998370-68998392 ATGCATATCATTGAGAAACATGG - Intergenic
932113727 2:69025435-69025457 CTGCATATCATTAAGCATCAGGG - Intronic
932649300 2:73538306-73538328 CTCTATATCATTAATCATGAGGG + Intronic
932961420 2:76416594-76416616 CTCAATATCATTAATCATCAAGG + Intergenic
933132141 2:78684858-78684880 CTCAACATCATTAATCATCAGGG + Intergenic
933319411 2:80754805-80754827 ATGAACATCATTAATCATCAGGG + Intergenic
933458574 2:82549140-82549162 CTCAACATCATTAATCATCATGG - Intergenic
933474748 2:82775896-82775918 CTCAATATCATTAATTATCAGGG + Intergenic
934044147 2:88157836-88157858 CTCCACATCACTAATCATCAGGG - Intergenic
935430147 2:102967223-102967245 CCTCATATCACAAAGCATCATGG - Intergenic
935752309 2:106247055-106247077 CTTAATATCACTAACCATCAGGG + Intergenic
935835179 2:107043294-107043316 CTAAATATCACTAATCATCAGGG + Intergenic
935912720 2:107914594-107914616 CTTAATATCACTAACCATCAGGG + Intergenic
935964191 2:108456435-108456457 CTCAATATCACTAATCATCAGGG - Intronic
936120415 2:109737816-109737838 CTTAATATCACTAACCATCAGGG - Intergenic
936224278 2:110633630-110633652 CTTAATATCACTAACCATCAGGG + Intergenic
936858987 2:116993489-116993511 CTGCATAAAATTAACCATCACGG - Intergenic
937445648 2:121955627-121955649 CAGCAGATCATTAAGCGTAAAGG - Intergenic
937740335 2:125344953-125344975 CTTGATATCATTAAGCATCAGGG + Intergenic
937947928 2:127358214-127358236 CTCAATATCATTAGTCATCATGG + Intronic
938155394 2:128934381-128934403 CTCAATATCACTAATCATCAGGG - Intergenic
938999641 2:136719380-136719402 CTCCACATCACTAATCATCAGGG + Intergenic
939171084 2:138696501-138696523 CTCCATCTCATTAGTCATCAGGG + Intronic
939265099 2:139862679-139862701 CTCAATATCATTAATCATTAGGG + Intergenic
939415541 2:141891774-141891796 CTTCATATTAATAAGCATTAGGG + Intronic
939556444 2:143679824-143679846 ATTCATATCATTCAGTATCAGGG + Intronic
940028384 2:149233631-149233653 CTCAACATCATTAATCATCAGGG + Intergenic
940201384 2:151155052-151155074 CTCAATATCACTAATCATCAGGG + Intergenic
940749278 2:157606540-157606562 CTGAACATCACTAATCATCAGGG - Intronic
941385998 2:164852522-164852544 TTCAATATCATTAATCATCAGGG - Intergenic
941717352 2:168778026-168778048 CTGCACATCATATATCATCAGGG + Intergenic
942539863 2:177004500-177004522 CTCAACATCATTAATCATCAAGG + Intergenic
942977836 2:182040391-182040413 CTCAATATCACTAATCATCAGGG - Intronic
943006074 2:182389496-182389518 CTTAATATCAGTAATCATCAGGG + Intronic
943619584 2:190133339-190133361 CTCAACATCATTAATCATCAGGG + Intronic
944254464 2:197611033-197611055 CTTCATATCATTGTTCATCAGGG + Intronic
944259593 2:197661879-197661901 CTGAATATCACTAATCACCAGGG - Intronic
944390511 2:199213913-199213935 CTCAATATCACTAATCATCAGGG + Intergenic
944475264 2:200097447-200097469 ATGCACATCATAAATCATCATGG - Intergenic
944603433 2:201327562-201327584 CTCAATATCACTAATCATCAGGG + Intronic
945318988 2:208399785-208399807 TAGCAAATCATTAAGCATGATGG + Intronic
945451171 2:209998080-209998102 ATAAATATCATTAAGTATCATGG - Exonic
946583383 2:221155843-221155865 TTTCATATTCTTAAGCATCATGG - Intergenic
946746910 2:222855211-222855233 CTGCATATCATTGAGGACCTGGG - Intergenic
948397203 2:237654263-237654285 CTTGACATCATTAATCATCAGGG + Intronic
1168858912 20:1030852-1030874 CTGAACATCATTATTCATCAGGG + Intergenic
1168927994 20:1598730-1598752 CCACATATCATGCAGCATCAGGG - Intronic
1169094486 20:2884514-2884536 ATGCACATCATAAATCATCATGG - Intronic
1169504762 20:6197620-6197642 CTGGATATCTCTAATCATCATGG - Intergenic
1169637209 20:7705720-7705742 CTCAATATCATTAATTATCAGGG - Intergenic
1169798295 20:9489419-9489441 CTTAATACCATTAAGGATCAGGG - Intergenic
1169897502 20:10519952-10519974 CTCAATATCATTAGCCATCAAGG - Intronic
1169996201 20:11559471-11559493 CTCAATATCACTAATCATCAGGG + Intergenic
1170260315 20:14398489-14398511 CTCCACATCACTAATCATCAGGG - Intronic
1170693540 20:18636906-18636928 CTGCATTTTAGTAAGCACCATGG - Intronic
1171137024 20:22704168-22704190 CTGAATATCACTAATCAACAGGG - Intergenic
1171804004 20:29657576-29657598 CTCAACATCATTAATCATCAGGG + Intergenic
1171840052 20:30198891-30198913 CTCAACATCATTAATCATCAGGG - Intergenic
1172957880 20:38774376-38774398 CTCCACATCACTAATCATCACGG - Intergenic
1173355678 20:42286993-42287015 CTCAATATCACTAATCATCAGGG + Intronic
1173777408 20:45722105-45722127 CTGCATATATTTAATCATGAAGG - Intergenic
1174280969 20:49438898-49438920 CTGCATCTCATAACGCATCCAGG + Intronic
1174372303 20:50099706-50099728 CTTCATCTCAATAAGGATCAAGG + Intronic
1176581955 21:8538631-8538653 CTCAACATCATTAATCATCAGGG + Intergenic
1176738950 21:10580093-10580115 CTAAACATCATTAATCATCAGGG - Intronic
1177588175 21:23126392-23126414 CTCAACATCATTAATCATCAGGG - Intergenic
1177957283 21:27614523-27614545 CTCCACATCACTAATCATCATGG - Intergenic
1178274125 21:31220928-31220950 CTGCAAATCACTCAGCATTATGG + Intronic
1179118329 21:38517361-38517383 CTCAATATCACTAATCATCAGGG + Intronic
1179196328 21:39166354-39166376 CTCAATATCATTAAATATCAGGG - Intergenic
1180264792 22:10515691-10515713 CTCAACATCATTAATCATCAGGG + Intergenic
1180652921 22:17393739-17393761 CTCAACATCATTAAGCATGAGGG - Intronic
1181404920 22:22677234-22677256 CTCAATATCACTAATCATCAGGG + Intergenic
1181918476 22:26300063-26300085 CTTGACATCATTAATCATCAGGG - Intronic
1182215551 22:28714305-28714327 CTGAATATCATTAGTCATTAGGG - Intronic
1182247681 22:28972812-28972834 CTCAATATCATTAGCCATCAAGG - Intronic
1182559255 22:31146666-31146688 CTCAATATCATTAGTCATCAGGG - Intergenic
1183088527 22:35504315-35504337 CTTAATGTCATTAATCATCAGGG + Intergenic
1183242126 22:36665621-36665643 CTTAATATCATTAATCATTAAGG + Intronic
949159630 3:864983-865005 TTTCATATCACTAAGCATTAGGG - Intergenic
950688733 3:14638617-14638639 CTCAACATCATTAACCATCAGGG - Intergenic
951088928 3:18549200-18549222 CTCAATATCATTAGTCATCAGGG - Intergenic
951158871 3:19390759-19390781 CTGCATATCACTGGGCATCAGGG - Intronic
951358485 3:21697850-21697872 CTCAATACCATTAATCATCACGG + Intronic
951617600 3:24565882-24565904 CTCAATATCATTAATCATCTGGG + Intergenic
951834547 3:26967669-26967691 CTCAATATCATTAGTCATCAAGG - Intergenic
951900385 3:27652169-27652191 CTGAATATCACTAATTATCAGGG - Intergenic
951988898 3:28653465-28653487 TTCAATATCATTAATCATCAGGG - Intergenic
952024440 3:29061853-29061875 CTCAATATCACTAATCATCAGGG + Intergenic
952026935 3:29094098-29094120 CTCAATATCACTAATCATCAGGG - Intergenic
952897999 3:38091756-38091778 CTCAACATCATTAATCATCAGGG + Intronic
953156432 3:40379028-40379050 CTCAACATCATTAATCATCAGGG + Intergenic
953266932 3:41399241-41399263 CTCCACATCATTAGCCATCAGGG - Intronic
953361257 3:42299260-42299282 CTGCAGAACATTAAGGATGAAGG + Intergenic
955913770 3:63885344-63885366 CTCAATATCACTAATCATCAGGG + Intronic
955960718 3:64338906-64338928 CTCAATATCATTAGCCATCAGGG + Intronic
956188991 3:66590467-66590489 CTCAATATCATTAATCATCAGGG - Intergenic
957257471 3:77856706-77856728 CTCCACACCATTAATCATCAGGG + Intergenic
957629285 3:82697772-82697794 CTTAATATCATTAGTCATCAGGG + Intergenic
959078055 3:101772031-101772053 CTGAACATCATTAATCATTAGGG - Intergenic
959613577 3:108322142-108322164 CTGCTTAACATTAAGAATGAGGG + Intronic
959993715 3:112657426-112657448 CTCAACATCATTAACCATCAAGG - Intergenic
960379670 3:116944715-116944737 CTGAATATCACTCATCATCAGGG + Intronic
960468133 3:118024354-118024376 CTCAATATCACTAATCATCAGGG - Intergenic
960483074 3:118216820-118216842 CTCAATATCACTAATCATCAGGG + Intergenic
961344429 3:126254037-126254059 CTGCATTCCATGAATCATCATGG + Intergenic
962262221 3:133918764-133918786 CTTAATATCATTAGTCATCAAGG - Intergenic
962734463 3:138313010-138313032 CTCAATATCACTAATCATCAGGG + Intronic
962954825 3:140255052-140255074 CTTCATATCAGTAATCATTAGGG + Intronic
963029556 3:140954618-140954640 CTGCAAATCATTTGTCATCAGGG - Intronic
963170897 3:142250346-142250368 CTACATTTCATTAATCATCAGGG + Intergenic
963405474 3:144857812-144857834 CTGGACATCACTAATCATCAGGG - Intergenic
965000979 3:162953047-162953069 ATGCTTATCATTAATTATCAGGG + Intergenic
965493658 3:169370787-169370809 CTGAATATCACTAGTCATCATGG + Intronic
965745840 3:171925185-171925207 CTGAATATCACTAATGATCAGGG + Intronic
966005207 3:175002510-175002532 CAGCATATCATTAAGTGGCATGG - Intronic
966018902 3:175182135-175182157 CTCAATATCACTAATCATCAGGG - Intronic
966362109 3:179141268-179141290 CTCCATATCACTAATCATTAGGG + Intergenic
966369333 3:179231538-179231560 CTCAACATCATTAATCATCAGGG - Intronic
966972578 3:185058928-185058950 CTCAATATCACTAATCATCAGGG + Intergenic
968078505 3:195830440-195830462 CTCCATATCACTAACCCTCAGGG + Intergenic
970284077 4:14489956-14489978 CTGAATATCACTAATTATCAGGG + Intergenic
970903562 4:21188744-21188766 CTTCATAGCATTAACCATCATGG + Intronic
971425774 4:26513888-26513910 CTCAATATCACTAATCATCAGGG - Intergenic
971442631 4:26705006-26705028 CTCAATATCATTAATCATTAGGG - Intronic
971447842 4:26771096-26771118 CTCAATATCACTAATCATCAGGG + Intergenic
971643064 4:29160050-29160072 ATGCATAGCAGTAAGCATAAAGG - Intergenic
972702180 4:41504678-41504700 GAGCATATCAGTAAGAATCAAGG - Intronic
972764330 4:42137845-42137867 CTCAACATCATTAATCATCAGGG + Intronic
973579387 4:52326174-52326196 CTGAACATCACTAATCATCAGGG - Intergenic
973790407 4:54372919-54372941 CTCAACATCATTAACCATCAGGG + Intergenic
973922134 4:55698072-55698094 CTCAATATCATTAATCATCAGGG + Intergenic
974372645 4:61037631-61037653 CTTCATATCACTAATTATCATGG - Intergenic
974824751 4:67113842-67113864 CTCAATATCATTAGCCATCAGGG - Intergenic
974918589 4:68207825-68207847 CTCAACATCATTAACCATCAGGG + Intergenic
974953740 4:68614098-68614120 CTGAACATCAGTAACCATCAGGG + Intronic
975275227 4:72490100-72490122 CTCCACATCACTAATCATCAGGG - Intronic
975390248 4:73807871-73807893 CTCAATATCATTAATCATTAGGG + Intergenic
975454103 4:74569187-74569209 CTTAACATCATTAATCATCAGGG + Intergenic
975494630 4:75024289-75024311 CTCCATGTCATTAATCAGCAAGG - Intronic
975638376 4:76473717-76473739 CTCAATATCATTAATCACCAGGG + Intronic
975817844 4:78237722-78237744 CTGCATTTCATTAAGCTCCCAGG - Intronic
976014654 4:80537095-80537117 CTCAACATCATTAATCATCAGGG + Intronic
976136448 4:81942508-81942530 CTCAATATCACTAATCATCAAGG + Intronic
976880024 4:89910055-89910077 TTGCATAACATTAGCCATCATGG - Intronic
977073952 4:92429841-92429863 CTCCATATCATTGATCATCAAGG - Intronic
977300990 4:95267529-95267551 CTGAATATCATTAAGCATTTAGG + Intronic
977417889 4:96758310-96758332 CTCAACATCATTAATCATCAGGG - Intergenic
977719074 4:100217756-100217778 CTCAACATCATTAATCATCAGGG - Intergenic
977782834 4:100997668-100997690 CTTAATATCACTAATCATCATGG + Intergenic
977811721 4:101363226-101363248 CTGAATATCATAACACATCAGGG - Intergenic
978045507 4:104121438-104121460 CTCAATATCACTAATCATCAGGG + Intergenic
978450352 4:108826603-108826625 CTGCAGATCATTTGTCATCACGG + Intronic
978465270 4:109001961-109001983 CTCCACATCACTAATCATCAAGG + Intronic
980445359 4:132898841-132898863 CTTCATATCACTAATCATCAAGG + Intergenic
981297621 4:143150243-143150265 CTCAATATCATTGATCATCAGGG - Intergenic
981667815 4:147249782-147249804 CTACATATTATTAATCATTATGG + Intergenic
981860732 4:149353187-149353209 CTCAACATCATTAATCATCAGGG + Intergenic
981889815 4:149722032-149722054 CTCCATATCACTAATCATCAGGG - Intergenic
981923342 4:150111226-150111248 CTCCACATCATTAATCATCTGGG - Intronic
982187484 4:152817857-152817879 CTCAATATCATTAACCATTAGGG + Intronic
982834211 4:160103207-160103229 CTCAACATCATTAACCATCAGGG + Intergenic
983010753 4:162543772-162543794 CTGAATATCACTAATTATCAGGG - Intergenic
983347387 4:166544475-166544497 CTGAATATCGCTAAACATCAGGG + Intergenic
983821464 4:172198518-172198540 TTGCATTTCTTTAATCATCAGGG - Intronic
984369447 4:178843491-178843513 CTGAATACCATTAATCATCAAGG + Intergenic
984462043 4:180050275-180050297 GTGAATTTCATTAAGCTTCAAGG - Intergenic
984463869 4:180072165-180072187 TTGCATATAATTAAGGATCCTGG - Intergenic
985032309 4:185801557-185801579 CTCAACATCACTAAGCATCATGG - Intronic
985263061 4:188132754-188132776 CTCAATATCACTAATCATCAGGG - Intergenic
987144399 5:14978303-14978325 CTAAATATCATGAAGCATCAGGG - Intergenic
987233723 5:15921746-15921768 CTCAATATCACTAATCATCAGGG + Intronic
987264601 5:16239765-16239787 CTGAACATCACTAATCATCAGGG + Intergenic
987573218 5:19692632-19692654 CTAGATATCACTAATCATCAGGG + Intronic
988072842 5:26316446-26316468 CTTAACATCATTAATCATCAGGG - Intergenic
988715153 5:33818824-33818846 CTGAACATCACTAATCATCAAGG - Intronic
988809827 5:34773657-34773679 CTCAACATCACTAAGCATCAGGG + Intronic
989065434 5:37456336-37456358 CTCAATATCACTAATCATCAGGG - Intronic
989221668 5:38972509-38972531 CTCAATATCATTAGTCATCAGGG + Intronic
989407806 5:41080882-41080904 CTCCACATCATTAATCCTCAGGG - Intergenic
989523315 5:42425078-42425100 CTGCATAGGATTAAGTATTAAGG + Intronic
989982486 5:50661153-50661175 CTCAATATCATTAATAATCAGGG + Intergenic
991219129 5:64192217-64192239 CTTAATATCAGTAATCATCAGGG + Intronic
992302716 5:75400568-75400590 CTGCATAGCATTATTTATCATGG + Intronic
992416225 5:76554564-76554586 CTGAATATCATTAGCCATCAGGG + Intronic
992461429 5:76964345-76964367 CTGCAGATCATTAACCAGCTAGG + Intronic
992525258 5:77603305-77603327 CTCAACATCATTAATCATCAGGG - Intronic
992705316 5:79385501-79385523 CTCAATATCACTAATCATCAAGG + Intronic
992727590 5:79625138-79625160 CTCAATATCATTAGGCATTAGGG - Intronic
992746246 5:79823867-79823889 ATCCACATCATTAATCATCAGGG - Intergenic
993303914 5:86250932-86250954 CTCAATATCACTAATCATCAGGG + Intergenic
993401836 5:87462924-87462946 CTCAACATCATTAATCATCAGGG - Intergenic
993447989 5:88038195-88038217 CTCAATATCACTAATCATCAAGG - Intergenic
994277189 5:97853714-97853736 CTCAATATCACTAATCATCAGGG + Intergenic
994326479 5:98452584-98452606 CTCAATATCACTAATCATCAAGG + Intergenic
994419247 5:99512155-99512177 CTCAATATCACTAATCATCAGGG - Intergenic
994670049 5:102754260-102754282 CTGCACATCATCAAGCCTCTTGG + Intronic
995116793 5:108490150-108490172 CAACACATCATTAATCATCAGGG + Intergenic
995150058 5:108832864-108832886 CTGCTTGTCCTTAATCATCATGG - Exonic
995347881 5:111141753-111141775 CTCAACATCATTAATCATCAAGG + Intergenic
995503133 5:112830312-112830334 CTTAATATCATTAATCATCAGGG + Intronic
995701589 5:114941213-114941235 CTCAACATCATTAATCATCAGGG - Intergenic
996032395 5:118720611-118720633 CTGCACATCACTAATGATCAGGG + Intergenic
996081780 5:119265644-119265666 CTGCATATCCTCCAGCATCATGG - Intergenic
996237349 5:121147914-121147936 TTCAATATCATTAAGCATTAGGG - Intergenic
996400588 5:123058112-123058134 CTCCATGTCACTAAGCATCAGGG + Intergenic
996475834 5:123919552-123919574 CTCAATATCACTAATCATCAGGG - Intergenic
997005138 5:129807553-129807575 ATGCATATCATTAAGCACAGAGG + Intergenic
997049387 5:130361730-130361752 CTGCATATCAATAAACAAAAAGG - Intergenic
997594523 5:135097185-135097207 CTCCACATCACTAACCATCAGGG + Intronic
997673990 5:135698941-135698963 CTCCAGATCATTAGTCATCAGGG + Intergenic
997762930 5:136467632-136467654 CTCAATATCACTAATCATCAGGG - Intergenic
998198790 5:140100735-140100757 CTCAACATCACTAAGCATCAGGG - Intergenic
998770413 5:145537557-145537579 CTCAATATCACTAATCATCAGGG - Intronic
999019728 5:148151735-148151757 CTTGATATCCTTAAGCATCAGGG - Intergenic
999539124 5:152552638-152552660 CTCAATATCACTAATCATCAGGG + Intergenic
999650382 5:153761419-153761441 CTCCACATCACTAATCATCAGGG + Intronic
999855980 5:155594639-155594661 CAGCATATCATTGTGCATCAGGG - Intergenic
1000358199 5:160421597-160421619 CTCCATATTATTAAGCTGCATGG - Intronic
1000640938 5:163700653-163700675 TTCCATATCATTAAGTATAAGGG + Intergenic
1003705183 6:8520068-8520090 CTCAACATCATTAATCATCAGGG + Intergenic
1004786115 6:18969256-18969278 CTCAACATCATTAATCATCAGGG + Intergenic
1005003516 6:21265855-21265877 TTGCTCATCATTAATCATCAGGG + Intergenic
1005979002 6:30821779-30821801 CAGCTTATCAGTAAGCAGCATGG - Intergenic
1006045764 6:31296342-31296364 TTCAACATCATTAAGCATCAGGG + Intronic
1006075705 6:31530837-31530859 CTGCACATCATTGAGGATCTTGG + Exonic
1008239521 6:49092118-49092140 CTCAATATCATTAATCATCAAGG - Intergenic
1008488894 6:52064900-52064922 CTGAATATCTTTAATCATGATGG - Intronic
1008733212 6:54508592-54508614 CTCAATATCACTAATCATCAGGG + Intergenic
1008738111 6:54572115-54572137 CTCAATATCATTAATTATCAGGG - Intergenic
1009321401 6:62294267-62294289 CTCAATATCATTAATCATTAAGG + Intergenic
1009745721 6:67812742-67812764 CTCAATATCACTAATCATCAAGG - Intergenic
1010130031 6:72481036-72481058 ATGCATATCACTAATAATCAGGG + Intergenic
1010533095 6:76991103-76991125 CTGCTTCTCATTATCCATCAGGG - Intergenic
1010566391 6:77419582-77419604 CTCAATATCACTAATCATCAGGG + Intergenic
1011046906 6:83094622-83094644 CTCCACATAATTAATCATCAGGG - Intronic
1011334438 6:86244583-86244605 CTCAACATCATTAATCATCAGGG - Intergenic
1011454106 6:87528151-87528173 CTGAACATCACTAATCATCAGGG + Intronic
1012005741 6:93711049-93711071 CTCAATATCACTAATCATCAGGG - Intergenic
1012156329 6:95824185-95824207 CTCAATATCACTAAGGATCAGGG + Intergenic
1012230671 6:96757767-96757789 AGGCATATCATTAAGAAACATGG + Intergenic
1012536461 6:100303866-100303888 CTCAATATCACTAACCATCAGGG - Intergenic
1012578770 6:100837125-100837147 CTCAATATCACTAATCATCAGGG + Intronic
1013379023 6:109547961-109547983 CTCAATATCACTAATCATCAGGG + Intronic
1014093656 6:117435263-117435285 CTCAATATCATTAATCATTAGGG - Intronic
1014393597 6:120895479-120895501 CTCAATATCACTAATCATCAGGG + Intergenic
1014606964 6:123487535-123487557 CAGCATTTCATGAAGCATGATGG - Intronic
1014758926 6:125333620-125333642 CTCAATATCACTAATCATCAAGG - Intergenic
1014833979 6:126137392-126137414 CTCAATATCACTAATCATCAGGG + Intergenic
1015208959 6:130673941-130673963 CTCAATATCACTAATCATCAAGG + Intergenic
1016787238 6:148024571-148024593 CTTAATATCATTAATCATCAAGG - Intergenic
1017424912 6:154310274-154310296 CTGAACATCACTAACCATCAGGG + Intronic
1017749258 6:157474651-157474673 TTGCATATCTCTAATCATCAAGG - Intronic
1017861988 6:158407277-158407299 CTCCGCATCATTAACCATCAGGG + Intronic
1017986334 6:159446022-159446044 CTGCAGATCACACAGCATCAGGG + Intergenic
1018241233 6:161776832-161776854 CTCGATATCATTAAGCAACCAGG - Intronic
1018957767 6:168422073-168422095 CTCAACATCATTAATCATCAGGG - Intergenic
1019053952 6:169206559-169206581 CCACATATCCATAAGCATCAAGG + Intergenic
1019654334 7:2181439-2181461 CTAAATATCATTAATTATCAGGG + Intronic
1020814274 7:12885595-12885617 CTGGACATCATTAGTCATCAGGG + Intergenic
1020903316 7:14033271-14033293 CTCAATATCACTAATCATCAGGG - Intergenic
1020942650 7:14560932-14560954 CTCAATATTATTAATCATCAGGG - Intronic
1021105411 7:16632989-16633011 CTCAACATCATTAACCATCAGGG - Intronic
1021144982 7:17074916-17074938 CTCAACATCATTAACCATCAGGG - Intergenic
1021562019 7:21977825-21977847 CTTAATATTATTAATCATCAGGG + Intergenic
1021893330 7:25209327-25209349 CTCAATATCATTAATTATCATGG - Intergenic
1022381543 7:29865311-29865333 CTGCATTTCAGAAAGCATCTGGG - Intronic
1022402926 7:30058039-30058061 CTCAATATCATTAGTCATCATGG - Intronic
1022751369 7:33229997-33230019 CTCAACATCATTAATCATCAGGG - Intronic
1023509808 7:40939626-40939648 CTCAATATCACTAATCATCAGGG - Intergenic
1023536103 7:41213046-41213068 CTAAATATCATTGATCATCAGGG - Intergenic
1023594954 7:41819496-41819518 CTGAACATCACTAATCATCAGGG - Intergenic
1024285533 7:47754096-47754118 CTTCATATCACTAATCATCAGGG - Intronic
1024317114 7:48031284-48031306 CTCAACATCATTAATCATCAGGG + Intergenic
1024782703 7:52870342-52870364 ATGCACATCACTAATCATCAGGG + Intergenic
1025288571 7:57690319-57690341 CTCAACATCATTAATCATCAGGG - Intergenic
1026240058 7:68565905-68565927 CTGCATATCATTAAGTTTTGGGG - Intergenic
1027568126 7:79824741-79824763 CTCAATATCACTAATCATCAAGG - Intergenic
1027573364 7:79900798-79900820 CTCAACATCACTAAGCATCAGGG + Intergenic
1028140639 7:87271052-87271074 CTGCACATCACTATTCATCAAGG - Intergenic
1028364925 7:90017475-90017497 ATGCATATCATTAAGGAAAAAGG - Intergenic
1028775963 7:94676592-94676614 CTCAATATCACTAATCATCAGGG - Intergenic
1028814412 7:95128252-95128274 CTCCATATCACTAATCACCAGGG - Intronic
1028878292 7:95848967-95848989 CTCAACATCATTAATCATCAGGG - Intronic
1030391697 7:108936339-108936361 CTTTATATCACTAATCATCAGGG + Intergenic
1030529190 7:110691708-110691730 ATGCACATCACTAATCATCAGGG + Intronic
1030605941 7:111639243-111639265 CTCCCCATCATAAAGCATCATGG + Intergenic
1030831709 7:114232110-114232132 CTCAATATCACTAATCATCAGGG + Intronic
1032519252 7:132530489-132530511 CTGCATTTCATTAGCCATTAGGG + Intronic
1033122152 7:138675803-138675825 CTGATTATCATTATGCATCTGGG + Intronic
1033462627 7:141561508-141561530 CTCAATATCACTAATCATCAGGG - Intronic
1035289541 7:157828941-157828963 CTGTATTTCTTTATGCATCATGG + Intronic
1036109560 8:5882832-5882854 CTGCATTTTTTTCAGCATCATGG + Intergenic
1037276828 8:17189335-17189357 CTCCATAACATTTACCATCATGG + Intronic
1037376188 8:18232238-18232260 CTCCACATCATTAGTCATCAGGG + Intergenic
1039326798 8:36494149-36494171 ATGCATAGCATTATGAATCAAGG - Intergenic
1039625028 8:39040421-39040443 CTCAATATCATTAATCATCAAGG - Intronic
1040087360 8:43358813-43358835 CTAAATATCACTAATCATCAGGG - Intergenic
1041604620 8:59766357-59766379 CTCAATATCATTAGTCATCAAGG + Intergenic
1042297145 8:67233237-67233259 CTGCATTTCTTTAAACATTAAGG - Intronic
1042354737 8:67814763-67814785 CTAAATATCACTAATCATCAGGG + Intergenic
1042690894 8:71497473-71497495 CTTGATATCACTAATCATCAGGG + Intronic
1042725508 8:71870805-71870827 CTCCACATCACTAATCATCAGGG - Intronic
1042882468 8:73509234-73509256 CTGAATGTCATTAGCCATCAGGG - Intronic
1043030300 8:75126074-75126096 CTCAATATCATTAGTCATCAGGG + Intergenic
1044678352 8:94752202-94752224 CCCAATATCATTAATCATCAGGG - Intronic
1045045388 8:98270423-98270445 CTGAACATCACTAATCATCAGGG - Intronic
1045337416 8:101220473-101220495 CTCAATATCACTAATCATCAGGG + Intergenic
1045824484 8:106380706-106380728 CTCCACATCATTAATCACCAGGG - Intronic
1045846917 8:106647948-106647970 CTGCAAATCTTTAAGCAAAATGG - Intronic
1046147004 8:110173402-110173424 CTCAACATCATTAATCATCAGGG + Intergenic
1046411733 8:113853301-113853323 CTCAACATCATTAATCATCAGGG + Intergenic
1047383805 8:124389461-124389483 CTGAATATCACTAATCATCAAGG - Intergenic
1047458024 8:125034139-125034161 CTCAAAATCATTAATCATCAGGG + Intronic
1048233440 8:132666543-132666565 CTGGATACCATGAAGCATCTAGG + Intronic
1048415317 8:134221830-134221852 CTCAATATCACTAATCATCAGGG + Intergenic
1049073532 8:140375571-140375593 CTGCATATCCCTAAGAAACAGGG + Intronic
1049831696 8:144705020-144705042 CTGCATTTCCTTCAGCATGAAGG - Intergenic
1050806533 9:9687157-9687179 CAGCACATCATTAACCATAAAGG + Intronic
1051578305 9:18643161-18643183 CTCAACATCATTAATCATCAGGG - Intronic
1052084760 9:24250776-24250798 CTCAACATCATTAACCATCAGGG - Intergenic
1052142797 9:25008100-25008122 CTGCTTAACAGTAATCATCAGGG + Intergenic
1052186097 9:25596027-25596049 CTCAACATCATTAATCATCAGGG - Intergenic
1052262463 9:26533317-26533339 CTCAATATCACTAATCATCAGGG + Intergenic
1052504450 9:29334412-29334434 CTCAATATCACTAATCATCAGGG + Intergenic
1053156461 9:35784026-35784048 CTCAATATCACTAATCATCAGGG - Intergenic
1053180843 9:35968540-35968562 CTCAATATCAGTAATCATCAGGG - Intergenic
1053262404 9:36679953-36679975 CTCTACATCATTAATCATCACGG - Intergenic
1053542510 9:38988992-38989014 CTGCATTAGTTTAAGCATCATGG + Intergenic
1053806963 9:41812509-41812531 CTGCATTAGTTTAAGCATCATGG + Intergenic
1054623629 9:67374918-67374940 CTGCATTAGTTTAAGCATCATGG - Intergenic
1055178746 9:73355635-73355657 CAGCCAATTATTAAGCATCAAGG + Intergenic
1055469501 9:76597213-76597235 CTCAACATCATTAATCATCAGGG - Intergenic
1055940128 9:81641682-81641704 CTCAATATCATTAATCATGAAGG + Intronic
1056027082 9:82510008-82510030 CTCAATATCAGTAATCATCAGGG + Intergenic
1056087713 9:83168714-83168736 CTTAACATCATTAATCATCAGGG + Intergenic
1056095511 9:83249700-83249722 CTGAACATCATTAATCATTAGGG + Intronic
1056234878 9:84584907-84584929 CTGTGTTTCATTAAGCATGAGGG - Intergenic
1056749963 9:89342183-89342205 CTCAATATCATTAGTCATCAGGG + Intronic
1057240984 9:93408854-93408876 CTCGATATCACTAATCATCAGGG - Intergenic
1058005797 9:99912355-99912377 CTCAACATCATTAATCATCAGGG - Intronic
1058199131 9:102017027-102017049 CTGCATATCATATGTCATCAGGG + Intergenic
1058338784 9:103868396-103868418 TTTAATATCATTAACCATCATGG + Intergenic
1059509590 9:114831973-114831995 CTCAAAATCATTAATCATCAGGG - Intergenic
1059580137 9:115536453-115536475 CTCAAAATCATTAAGCCTCAGGG + Intergenic
1060264570 9:122103163-122103185 CTCCACATCATTCACCATCAAGG + Intergenic
1203611972 Un_KI270749v1:16669-16691 CTCAACATCATTAATCATCAGGG + Intergenic
1185928527 X:4174005-4174027 CTCAACATCATTAATCATCAGGG - Intergenic
1186627463 X:11309836-11309858 CTTGATATCATTAGCCATCAGGG + Intronic
1186691709 X:11984940-11984962 CTCCTTATCATTAATCATTAGGG + Intergenic
1186734003 X:12441538-12441560 CTGCCTATCATTTTGCATCCTGG - Intronic
1186932826 X:14413590-14413612 CTCAATATCATTGATCATCAAGG - Intergenic
1186972860 X:14867960-14867982 CTCAATATCACTAATCATCAGGG + Intronic
1187196464 X:17090116-17090138 CTCAACATCATTAATCATCAGGG - Intronic
1187847009 X:23550181-23550203 CTCAACATCATTAATCATCAGGG - Intergenic
1188047616 X:25445765-25445787 CTTAATATCACTAATCATCAGGG + Intergenic
1188054115 X:25521982-25522004 CTGCATATCAGAAATCACCAGGG - Intergenic
1188471100 X:30540235-30540257 CTCAATATCACTAATCATCAGGG + Intergenic
1188717978 X:33484523-33484545 CTCAACATCATTAATCATCAGGG + Intergenic
1188794973 X:34452355-34452377 TTTGATATCATTAACCATCAGGG + Intergenic
1188846843 X:35083535-35083557 AAGCATATCGTTAAGCAGCAAGG + Intergenic
1189123290 X:38418226-38418248 CTGAGTATCATTAATCATTAGGG - Intronic
1189540894 X:41987223-41987245 CTCAATATCACTAATCATCAGGG + Intergenic
1189673138 X:43433487-43433509 CTCAATATCACTAATCATCAGGG + Intergenic
1189901085 X:45706959-45706981 CTGAATATCACTAATCATTATGG + Intergenic
1190009645 X:46773289-46773311 CTCAACATCATTAATCATCAAGG + Intergenic
1190434839 X:50413606-50413628 CTCAATATCATTAATCATTAAGG + Intronic
1190531543 X:51383587-51383609 CTCCATATCACTAATCATCAGGG + Intergenic
1190746148 X:53322841-53322863 CTCAACATCATTAACCATCAGGG + Intergenic
1191721903 X:64237959-64237981 CTCAATATCATTAATCATTAGGG - Intergenic
1191764026 X:64677108-64677130 CTCAATGTCATTAATCATCAGGG + Intergenic
1192241057 X:69328865-69328887 CTCAATATCACTAATCATCAGGG - Intergenic
1192822903 X:74663120-74663142 CTCAACATCATTAATCATCAGGG - Intergenic
1193069442 X:77292667-77292689 CTGAATATCATTAATCTTTAAGG + Intergenic
1193220412 X:78919139-78919161 CTCAACATCATTAACCATCAGGG - Intergenic
1193313704 X:80039449-80039471 CTGCATTTCATGACTCATCATGG - Intergenic
1193429201 X:81379398-81379420 CTCCACATCATTAGTCATCAGGG - Intergenic
1193511190 X:82401703-82401725 CTCCATATTACTAATCATCAGGG - Intergenic
1193550591 X:82887888-82887910 CTCAACATCATTAATCATCAAGG + Intergenic
1193681466 X:84524700-84524722 CTCAATATTATTAATCATCAGGG + Intergenic
1193908097 X:87267142-87267164 ATGCTCATCATTAATCATCAGGG - Intergenic
1193953637 X:87830464-87830486 CTTAATATTACTAAGCATCAGGG - Intergenic
1194469015 X:94269214-94269236 CTTCATATCTTTCAGCATCATGG + Intergenic
1194623383 X:96200265-96200287 CTCAATATCATTAGTCATCAAGG + Intergenic
1195059055 X:101176511-101176533 CTGAAGATCACTAATCATCAGGG - Intergenic
1195073011 X:101299300-101299322 CTCAATATCATTAGCCATCAGGG - Intergenic
1195293077 X:103447943-103447965 CTCAATATCACTAATCATCAGGG - Intergenic
1195465930 X:105178733-105178755 CTCAATATCACTAATCATCAGGG - Intronic
1195774934 X:108392521-108392543 CTCAATATCATTAGCCATCAGGG + Intronic
1195875107 X:109532641-109532663 CTCAATATCATTAGGTATCAGGG + Intergenic
1196460644 X:115925942-115925964 ATGCTCATCATTAATCATCAGGG + Intergenic
1196603998 X:117634876-117634898 CTCAATATCACTAATCATCAGGG + Intergenic
1197219207 X:123895675-123895697 CTCAATATCATTAATCATCAGGG - Intronic
1197243162 X:124141414-124141436 CTGCATTTCATGACTCATCATGG - Intronic
1197303555 X:124811415-124811437 CTGAACATCACTAATCATCAGGG + Intronic
1197548986 X:127864466-127864488 CTTAATATCACTAATCATCAGGG + Intergenic
1197553530 X:127925418-127925440 CTTAATATCACTAATCATCAGGG + Intergenic
1197858273 X:130942115-130942137 CTCAATATCACTAATCATCAAGG - Intergenic
1197895610 X:131310763-131310785 CTAAATATCATTAATCATCATGG + Intronic
1198411674 X:136375624-136375646 CTCAATATCACTAACCATCAGGG - Intronic
1198442130 X:136673410-136673432 CAGCAGATCATTTAGCATCGTGG - Intronic
1198474918 X:136985778-136985800 CTCAATATCATTAGTCATCAGGG - Intergenic
1198652575 X:138879108-138879130 CTCAATATCATTAATCATTAGGG - Intronic
1198949435 X:142053983-142054005 CTCAATATCACTAATCATCAGGG - Intergenic
1198993176 X:142540046-142540068 CTGAACATCACTAAACATCAGGG - Intergenic
1199507543 X:148582481-148582503 CTCAACATCATTAATCATCAGGG + Intronic
1199962845 X:152791948-152791970 CTGCCTTTCATTTAGCACCACGG - Intergenic
1201315137 Y:12637301-12637323 CTCAATATCACTAATCATCAGGG - Intergenic
1201367394 Y:13222910-13222932 CTGAACCTCATGAAGCATCAGGG + Intergenic
1202056365 Y:20835669-20835691 ATGCTTATCACTAATCATCATGG + Intergenic
1202597684 Y:26559622-26559644 CTAAACATCATTAATCATCAGGG - Intergenic