ID: 932117736

View in Genome Browser
Species Human (GRCh38)
Location 2:69068460-69068482
Sequence CTATTTGACCAGCTCTTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932117736_932117744 27 Left 932117736 2:69068460-69068482 CCCATGAAGAGCTGGTCAAATAG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 932117744 2:69068510-69068532 GTGAAGTGCCTATTGGAGAAAGG 0: 1
1: 0
2: 2
3: 8
4: 137
932117736_932117745 28 Left 932117736 2:69068460-69068482 CCCATGAAGAGCTGGTCAAATAG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 932117745 2:69068511-69068533 TGAAGTGCCTATTGGAGAAAGGG 0: 1
1: 0
2: 1
3: 5
4: 185
932117736_932117742 20 Left 932117736 2:69068460-69068482 CCCATGAAGAGCTGGTCAAATAG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 932117742 2:69068503-69068525 TGCCGATGTGAAGTGCCTATTGG 0: 1
1: 0
2: 0
3: 1
4: 40
932117736_932117746 29 Left 932117736 2:69068460-69068482 CCCATGAAGAGCTGGTCAAATAG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 932117746 2:69068512-69068534 GAAGTGCCTATTGGAGAAAGGGG 0: 1
1: 0
2: 2
3: 14
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932117736 Original CRISPR CTATTTGACCAGCTCTTCAT GGG (reversed) Intronic
912278376 1:108285755-108285777 CATTTTGAACATCTCTTCATAGG + Intergenic
912289850 1:108408602-108408624 CATTTTGAACATCTCTTCATAGG - Intronic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
916606970 1:166352723-166352745 CTATTTGTCCATCTCATCCTGGG + Intergenic
918913493 1:190604564-190604586 CTATCTCACCCCCTCTTCATTGG - Intergenic
920030384 1:203034251-203034273 CTGTTTGCCCAGCTCCTCACTGG - Intronic
920246759 1:204593590-204593612 CTCTTCCCCCAGCTCTTCATGGG - Intergenic
1067002804 10:42633568-42633590 GTATCTGAGCAGCTGTTCATGGG - Intronic
1068094467 10:52473071-52473093 GTATTTAACCAGCTCTTAAAGGG - Intergenic
1071321183 10:84459999-84460021 CTATTGAACCAGCTTTGCATTGG + Intronic
1072084240 10:92062847-92062869 CGATCTGATCAGCTCTGCATGGG - Intronic
1072366240 10:94713008-94713030 CTATTTGCCCATTTCTTAATTGG + Intronic
1073365426 10:102936242-102936264 ATATTTGAGCAGGTCTTCAGAGG + Intronic
1075214084 10:120516775-120516797 CTGTTTGTCCAGCCTTTCATGGG + Intronic
1077344615 11:2040460-2040482 CTATTTCCCCATCTGTTCATGGG - Intergenic
1080590605 11:33720152-33720174 CTATGTGCTAAGCTCTTCATAGG + Intronic
1081208754 11:40306046-40306068 CTCTTTGAGCAGCTCTTCCTTGG + Intronic
1081301571 11:41458873-41458895 CTGCTTCACCAGCTCTTAATTGG - Intronic
1083563122 11:63690152-63690174 CTTTTTGACCTGTTCCTCATTGG + Intronic
1085366754 11:75954744-75954766 CTATTTCACCAGATCTTTCTGGG - Intronic
1091304138 11:134526189-134526211 ATATGTGCCCAGCTCTTCAGAGG + Intergenic
1202827601 11_KI270721v1_random:95649-95671 CTATTTCCCCATCTGTTCATGGG - Intergenic
1100014804 12:89996286-89996308 CTATTTGAGCAGGGCTTGATGGG + Intergenic
1101316726 12:103635634-103635656 CCAGATGACCAGCTCTTCAGGGG - Intronic
1101914605 12:108886450-108886472 CTGTTTGAGCTGCTATTCATTGG - Intronic
1104199523 12:126574829-126574851 CTCTTTGACTAGCTCATAATAGG + Intergenic
1104613205 12:130246805-130246827 TTGTTTGCCCAGCTCTTCACAGG - Intergenic
1108862408 13:54878172-54878194 CAATTTGAACATGTCTTCATTGG - Intergenic
1110572505 13:77021558-77021580 CTGTTTGATCAGCTCTGGATGGG + Exonic
1111063057 13:83048991-83049013 GTATTTGACCAGCTTATCAGAGG + Intergenic
1111924314 13:94446423-94446445 CTAAATGCCCAGCTCCTCATTGG - Intronic
1112798522 13:103084348-103084370 CTATTTTATCTGCACTTCATAGG + Intergenic
1114563985 14:23614652-23614674 CTATTTGTCCTGCTCTGCATGGG + Intergenic
1114831230 14:26144365-26144387 CTTTTTGATGTGCTCTTCATTGG - Intergenic
1115096346 14:29640822-29640844 TGATTTGTCCAGCTTTTCATAGG - Intronic
1117739971 14:58807043-58807065 ATATTTGACCAGCTCATTAATGG + Intergenic
1120656374 14:87194988-87195010 TTATTTAACTAGTTCTTCATTGG - Intergenic
1120870892 14:89336583-89336605 CTGTGTGACCTGCTCTTTATAGG + Intronic
1122029620 14:98902675-98902697 CTCTTTGAGCAGGGCTTCATGGG + Intergenic
1122681094 14:103463790-103463812 CTGCTTGAACAACTCTTCATTGG + Intronic
1129484591 15:75857691-75857713 TTATTTAACCAACTCTTTATTGG - Intronic
1129920102 15:79312228-79312250 CTATTTGACCAGTTCCTCTGTGG + Intronic
1130276511 15:82479623-82479645 TTATTTAACCAACTCTTTATTGG + Intergenic
1130468877 15:84207020-84207042 TTATTTAACCAACTCTTTATTGG + Intergenic
1130475134 15:84259057-84259079 TTATTTAACCAACTCTTTATTGG - Intergenic
1130476367 15:84321571-84321593 TTATTTAACCAACTCTTTATTGG + Intergenic
1130482549 15:84373110-84373132 TTATTTAACCAACTCTTTATTGG - Intergenic
1130495398 15:84466559-84466581 TTATTTAACCAACTCTTTATTGG - Intergenic
1130507491 15:84559040-84559062 TTATTTAACCAACTCTTTATTGG + Intergenic
1130591171 15:85211619-85211641 TTATTTAACCAACTCTTTATTGG + Intergenic
1130736196 15:86552508-86552530 CTATTTGACCAGCCCCCCAGGGG + Intronic
1133896052 16:9929962-9929984 CCATTTGTCGAGCTATTCATTGG + Intronic
1134909104 16:18008184-18008206 CTCTTTGTCCAGATCTTCTTGGG + Intergenic
1137613154 16:49832514-49832536 CTATTTGAGGAGCTCTTCCTGGG - Intronic
1145000221 17:19299759-19299781 CTCTTTCACCAGCCCTGCATTGG + Intronic
1145197249 17:20905110-20905132 TTATTTGACAAGCTATTCAGTGG - Intergenic
1150707293 17:67498643-67498665 CTACTTGACAAGCTCATCAATGG + Intronic
1158635486 18:59152599-59152621 CTATTTCACCAGCTCTGATTGGG - Exonic
1166060579 19:40323091-40323113 CTATGCGCCCAGCTCTTCATAGG + Intronic
926412972 2:12624228-12624250 CTATTTGAAAAGCTCCTCTTTGG - Intergenic
930132970 2:47871576-47871598 TTATTTGAACATGTCTTCATAGG + Intronic
932117736 2:69068460-69068482 CTATTTGACCAGCTCTTCATGGG - Intronic
936071983 2:109377163-109377185 CTAATTGAGCAGCTTTTCAGGGG + Intronic
942215110 2:173711651-173711673 CTAGTTGACCAGCTGCTCATCGG + Intergenic
944146010 2:196508416-196508438 TTCTTTGACCAGCTCTTAAATGG - Intronic
946250694 2:218409893-218409915 GTATTTAACCAGTTCTTTATTGG - Intergenic
947800533 2:232926780-232926802 CTATTTGCCCAGCTCTTGTCTGG - Intronic
1168918145 20:1508457-1508479 CTCTATGACAAGCTCTTCCTTGG + Intergenic
1169359211 20:4933911-4933933 CTGTTTGAGGAACTCTTCATGGG + Intronic
1169604322 20:7299050-7299072 TTATTTGACCACATCTTCAAGGG + Intergenic
1175713393 20:61239263-61239285 CTCTTTGACCATCCATTCATGGG + Intergenic
1175713412 20:61239375-61239397 CTCTTTGACCATCCATTCATGGG + Intergenic
1175713422 20:61239431-61239453 CTCTTTGACCATCCATTCATGGG + Intergenic
1176029176 20:63002812-63002834 CTATTTGCCCAGCTCTAGAATGG + Intergenic
1179621936 21:42622137-42622159 CTATTTGAAAAGATCTTCAGGGG + Intergenic
1182753410 22:32659441-32659463 CTATTTCACAAACTCTTCCTGGG + Intronic
951995023 3:28717956-28717978 CTATCTGCCCAACTGTTCATAGG - Intergenic
959641706 3:108645396-108645418 CAATTTTAGCAGCTATTCATTGG + Intronic
964323167 3:155518929-155518951 TTATTTTACCAGCTCTGGATCGG - Intronic
971473503 4:27051156-27051178 CTTTTTGTCCAGGTTTTCATAGG + Intergenic
975037326 4:69699964-69699986 TAATTTGAAAAGCTCTTCATAGG - Intergenic
976010639 4:80484111-80484133 TTATTTCACCAGCTCTTTAGGGG - Intronic
976417384 4:84793496-84793518 GTACTTGACCAGCTCTTCATGGG - Intronic
976832672 4:89332775-89332797 CTCTTTGATCACCTCTTCATAGG - Intergenic
978389068 4:108205599-108205621 CTATTTGACCATCAATTTATTGG + Intergenic
979325786 4:119377997-119378019 CTCTTTGACCACTTCTACATAGG - Intergenic
980593156 4:134917749-134917771 CTATTTGAGCACATTTTCATTGG + Intergenic
981293834 4:143106865-143106887 CTCTTTGATCATCTTTTCATAGG + Intergenic
981878162 4:149574802-149574824 CTATTTGCCCATCTGTTCATAGG + Intergenic
982199617 4:152947546-152947568 CAGTTTGACCAGCTCTTAAGGGG + Intronic
983243700 4:165263124-165263146 CTCTTTGACCACTTCTACATAGG - Intronic
985882846 5:2653590-2653612 CTGTTCAGCCAGCTCTTCATTGG - Intergenic
991236111 5:64399290-64399312 CTATATGACAAGCTCCTCATGGG + Intergenic
996325008 5:122262857-122262879 CTATTTCAGCAGCTCTTCACAGG + Intergenic
998510271 5:142707221-142707243 ATCTTTCTCCAGCTCTTCATTGG + Intergenic
1007634699 6:43292133-43292155 CTATTTAACCAGCTCCATATTGG + Intergenic
1008255650 6:49296585-49296607 CTATTTCCCCAACTCTTAATAGG - Intergenic
1009879055 6:69542027-69542049 CTTTTAGACCAGCTGTTCTTTGG - Intergenic
1010888555 6:81274470-81274492 TTATTTGACCTGATTTTCATAGG - Intergenic
1016136468 6:140550052-140550074 CTATTTGTCCATCTTTTCTTTGG + Intergenic
1021949516 7:25761149-25761171 CTACTTGCCCAGCTCCTCCTAGG - Intergenic
1021949933 7:25764728-25764750 CTACTTGCCCAGCTCCTCCTAGG - Intergenic
1023212920 7:37827671-37827693 CTATGTGACCAGCTCCTTGTAGG - Intronic
1031645879 7:124224272-124224294 CTCTTTGGCCAGCTCCTCACAGG + Intergenic
1032508345 7:132452665-132452687 CAATATGGCCATCTCTTCATGGG + Intronic
1032552114 7:132793868-132793890 CTATTTTAGCAGTTCCTCATGGG - Intronic
1035596311 8:860866-860888 CTACTTTACCATTTCTTCATAGG - Intergenic
1039716839 8:40118942-40118964 CTATGGGGCCAGGTCTTCATGGG - Intergenic
1042026188 8:64426467-64426489 CAACTTAACCAGCTCTTCCTGGG - Intergenic
1043216315 8:77593932-77593954 ATATTTGACCAGATTGTCATGGG + Intergenic
1051114984 9:13684370-13684392 CTATTTGACGAGCTATGAATTGG + Intergenic
1052708918 9:32028393-32028415 CTCTTTGATCACCTCTTCTTAGG - Intergenic
1054702209 9:68424133-68424155 CTTTTTCAGCAGCTCTTCATAGG - Intronic
1054960728 9:70966065-70966087 CTATTTGCCCACTTCTTAATGGG - Intronic
1056336645 9:85575994-85576016 TTATTTGACCACTACTTCATTGG - Intronic
1057962879 9:99473783-99473805 CCATATCACCAGCTCTTCTTTGG + Intergenic
1060415344 9:123425947-123425969 TTTGTTCACCAGCTCTTCATGGG - Intronic
1186566328 X:10666797-10666819 CTATAAGACGAGCTTTTCATAGG + Intronic
1188093553 X:25993250-25993272 CAGTTTGATCAGCTCCTCATTGG + Intergenic
1190441958 X:50483634-50483656 CTACTCCACAAGCTCTTCATAGG + Intergenic
1193879344 X:86902085-86902107 CTATTTCACCAACTTTTCAATGG - Intergenic
1196118404 X:112022003-112022025 CCATGTGACCAGCACTTAATGGG + Intronic
1196723277 X:118874773-118874795 CTACCTGCCCAGCTCTTCAGAGG - Intergenic
1197945307 X:131832070-131832092 GTCTTTGATCAGCCCTTCATAGG + Intergenic
1199372221 X:147063701-147063723 CTTTTTGAACAGCTCTTCCAAGG + Intergenic
1200569189 Y:4806504-4806526 CTATTCAACAAGTTCTTCATAGG - Intergenic